The ITS2 database

GI 83272313

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 83272313

Accession DQ279063

Date 2011/04/01

Lineage root ; cellular organisms ; Eukaryota ; Fungi/Metazoa group ; Fungi ; Dikarya ; Basidiomycota ; Agaricomycotina ; Agaricomycetes ; Agaricomycetes incertae sedis ; Cantharellales ; Ceratobasidiaceae ; Ceratobasidium ; Ceratobasidium sp. AM70,4

Sequence ATGAAATCCTCAAAATAAATCTTTTGTTAATTCAACTGGTTTACTTTGGACTTGGAGGTCTTTGCAGATTTCACGTCTGCTCCTCTTAAATGCATTAGCTGGATCTGTATGAACTCGGTTCCACTCGGCGTGATAAGTATCACTCGCTGAGGACACTGTAAAAGGGGCCGGGATTATTATGAACCGCTTCTTAATAGTCCATTGACTTGGACAAACTACTTATGATAT

Structure .........(((((.((((((....(((.....))).)))))).)))))....(((((.....((((((.....)))))).)))))..........(((.((.((...((((.(((((((((.(((((((.(((....)))...)))))))............))))))))).))))...)).)))))........(((((......)))))................

Method 1: RNAfold - direct fold

Energy -59.5 kcal/mol

Model for

root

cellular organisms

Eukaryota

Viridiplantae

Streptophyta

Streptophytina

Embryophyta

Tracheophyta

Euphyllophyta

Spermatophyta

Coniferophyta

Coniferopsida

Coniferales

Pinaceae

Pinus

Strobus

Pinus monticola

38016219 (Method 2)

Fungi/Metazoa group

Fungi

environmental samples

uncultured soil fungus

90102738 (Method 2)

219968242 (Method 2)

262211822 (Method 2)

262211828 (Method 2)

262211845 (Method 2)

262211892 (Method 2)

262211908 (Method 2)

262211916 (Method 2)

262211919 (Method 2)

262211925 (Method 2)

262211927 (Method 2)

262211931 (Method 2)

295883744 (Method 2)

295883747 (Method 2)

uncultured fungus

71149076 (Method 2)

83722491 (Method 2)

121592412 (Method 2)

126843692 (Method 2)

126843707 (Method 2)

126843713 (Method 2)

126843717 (Method 2)

126843729 (Method 2)

126843752 (Method 2)

126843782 (Method 2)

126843798 (Method 2)

126843815 (Method 2)

126843831 (Method 2)

126843862 (Method 2)

126843893 (Method 2)

126843938 (Method 2)

126843949 (Method 2)

126843959 (Method 2)

126843970 (Method 2)

126843984 (Method 2)

133753053 (Method 2)

154543846 (Method 2)

187961707 (Method 2)

187961822 (Method 2)

187961825 (Method 2)

188496668 (Method 2)

193227129 (Method 2)

212379014 (Method 2)

212379038 (Method 2)

256855524 (Method 2)

256855525 (Method 2)

256855526 (Method 2)

299767813 (Method 2)

300077913 (Method 2)

300078018 (Method 2)

305854714 (Method 2)

uncultured ectomycorrhizal fungus

45720232 (Method 2)

108755810 (Method 2)

108755811 (Method 2)

108755812 (Method 2)

108755813 (Method 2)

190682945 (Method 2)

190682995 (Method 2)

224799076 (Method 2)

225728901 (Method 2)

283476342 (Method 2)

uncultured mycorrhizal fungus

145573184 (Method 2)

146424449 (Method 2)

146424450 (Method 2)

308082972 (Method 2)

unclassified Fungi

ectomycorrhizal root tip 238_Ny3.B2-34.1

18700698 (Method 2)

ectomycorrhizal root tip 70_Ny1.E2-17.2

19744411 (Method 2)

fungal sp. PN1

63148147 (Method 2)

fungal sp. C4-(2)II3

94466841 (Method 2)

fungal sp. D5-(2)II2

94466858 (Method 2)

fungal sp. 5EP8-6A

146218695 (Method 2)

fungal sp. 5EP10-5A

146218696 (Method 2)

fungal sp. 5DI8-1PL2

146218697 (Method 2)

fungal sp. 5GC4-5A

146218698 (Method 2)

fungal sp. 5GC5-1A

146218699 (Method 2)

fungal sp. 5EP11-1A

146218700 (Method 2)

fungal sp. 5EP12-2PL1

146218701 (Method 2)

fungal sp. 5EP12-10A

146218702 (Method 2)

fungal sp. 5GC2-1A

146218703 (Method 2)

fungal sp. 5GC3-4C

146218704 (Method 2)

fungal sp. JIA3-1-1

224830295 (Method 2)

Dikarya

Ascomycota

unclassified Ascomycota

Ascomycota sp. H-38

229597498 (Method 2)

environmental samples

uncultured Ascomycota

163257657 (Method 2)

saccharomyceta

Pezizomycotina

leotiomyceta

sordariomyceta

Leotiomycetes

Helotiales

Sclerotiniaceae

Sclerotinia

Sclerotinia spermophila

57161884 (Method 2)

mitosporic Sclerotiniaceae

Botrytis

Botrytis sp. SF113

291508712 (Method 2)

environmental samples

uncultured Helotiales

226938427 (Method 2)

226938433 (Method 2)

226938457 (Method 2)

Basidiomycota

Agaricomycotina

mitosporic Agaricomycotina

Rhizoctonia

Rhizoctonia sp. AG-A

1754578 (Method 2)

61612751 (Method 2)

62861806 (Method 2)

62861813 (Method 2)

62861817 (Method 2)

62861819 (Method 2)

62861821 (Method 2)

62861822 (Method 2)

62861824 (Method 2)

62861826 (Method 2)

62861828 (Method 2)

62861829 (Method 2)

62861830 (Method 2)

62861832 (Method 2)

62861833 (Method 2)

62861834 (Method 2)

62861835 (Method 2)

62861836 (Method 2)

62861838 (Method 2)

62861840 (Method 2)

62861841 (Method 2)

62861842 (Method 2)

62861843 (Method 2)

62861844 (Method 2)

62861846 (Method 2)

62861847 (Method 2)

62861848 (Method 2)

62861849 (Method 2)

62861850 (Method 2)

62861851 (Method 2)

62861852 (Method 2)

62861853 (Method 2)

62861854 (Method 2)

Rhizoctonia sp. VJ15

27527695 (Method 2)

Rhizoctonia sp. Oss2-2

27527696 (Method 2)

Rhizoctonia sp. ABN2-2

27527697 (Method 2)

Rhizoctonia sp. Pha1

27527698 (Method 2)

Rhizoctonia sp. Mo3b

27527699 (Method 2)

Rhizoctonia sp. Oss2

27527700 (Method 2)

Rhizoctonia sp. M1av2

27527701 (Method 2)

Rhizoctonia sp. M2ao1

27527702 (Method 2)

Rhizoctonia sp. ABN2

27527703 (Method 2)

Rhizoctonia sp. Abn1-2

27527704 (Method 2)

Rhizoctonia sp. ABn1

27527705 (Method 2)

Rhizoctonia sp. Moam3

27527706 (Method 2)

Rhizoctonia sp. Abn1b

27527707 (Method 2)

Rhizoctonia sp. Onv6

27527711 (Method 2)

Rhizoctonia sp. Bi8

27527713 (Method 2)

Rhizoctonia sp. Onv11c

27527714 (Method 2)

Rhizoctonia sp. Ogw8d

27527715 (Method 2)

Rhizoctonia sp. Onv11b

27527716 (Method 2)

Rhizoctonia sp. Ch5

27527717 (Method 2)

Rhizoctonia sp. Onv4b1

27527718 (Method 2)

Rhizoctonia sp. Onv11a

27527719 (Method 2)

Rhizoctonia sp. 251

19913079 (Method 2)

Rhizoctonia sp. 266

19913080 (Method 2)

Rhizoctonia sp. 268

19913081 (Method 2)

Rhizoctonia sp. 269

19913082 (Method 2)

Rhizoctonia sp. AV-2

18181855 (Method 2)

19913083 (Method 2)

Rhizoctonia sp. Eab-F1

18181597 (Method 2)

Rhizoctonia sp. Eab-F2

18181598 (Method 2)

Rhizoctonia sp. Eab-F3

18181599 (Method 2)

Rhizoctonia sp. Eab-S1

18181603 (Method 2)

Rhizoctonia sp. Eab-S2

18181604 (Method 2)

Rhizoctonia sp. Eab-S4

18181606 (Method 2)

Rhizoctonia sp. Eab-S5

18181607 (Method 2)

Rhizoctonia sp. Eab-S6

18181608 (Method 2)

Rhizoctonia sp. Eab-S7

18181844 (Method 2)

Rhizoctonia sp. Eab-A2

18181846 (Method 2)

Rhizoctonia sp. 184

18181856 (Method 2)

Rhizoctonia sp. FA59209

18181857 (Method 2)

Rhizoctonia sp. 76146

18181858 (Method 2)

Rhizoctonia sp. TC1

18181859 (Method 2)

Rhizoctonia sp. 76150

18181860 (Method 2)

Rhizoctonia sp. AG-G

61612749 (Method 2)

62861810 (Method 2)

62861811 (Method 2)

62861812 (Method 2)

62861814 (Method 2)

62861815 (Method 2)

62861816 (Method 2)

62861818 (Method 2)

62861820 (Method 2)

62861825 (Method 2)

62861837 (Method 2)

Rhizoctonia sp. 04M 156

62131068 (Method 2)

Rhizoctonia sp. R7

62861807 (Method 2)

Rhizoctonia sp. FC-R2

66096657 (Method 2)

Rhizoctonia sp. CLB111

225728589 (Method 2)

Rhizoctonia sp. KW214

225728590 (Method 2)

Rhizoctonia sp. Ppf49

299891157 (Method 2)

Rhizoctonia sp. E06f-11

319738925 (Method 2)

Agaricomycetes

Agaricomycetes incertae sedis

Cantharellales

Ceratobasidiaceae

Thanatephorus

Thanatephorus cucumeris

1101868 (Method 2)

1101880 (Method 2)

1101881 (Method 2)

1754548 (Method 2)

1854642 (Method 2)

1854644 (Method 2)

1854647 (Method 2)

1914817 (Method 2)

14586579 (Method 2)

14586580 (Method 2)

14586582 (Method 2)

27527708 (Method 2)

197253471 (Method 2)

197253472 (Method 2)

197253474 (Method 2)

226316720 (Method 2)

226316721 (Method 2)

257152872 (Method 2)

288921754 (Method 2)

288921756 (Method 2)

288921771 (Method 2)

288921792 (Method 2)

Rhizoctonia solani

Thanatephorus sp. 021R71

83272248 (Method 2)

Thanatephorus sp. T60

83272267 (Method 2)

Thanatephorus sp. 12-01

83272273 (Method 2)

Thanatephorus sp. R35

83272292 (Method 2)

Thanatephorus theobromae

224985457 (Method 2)

224985458 (Method 2)

224985459 (Method 2)

312984709 (Method 2)

312984710 (Method 2)

312984711 (Method 2)

312984712 (Method 2)

Ceratobasidium

Ceratobasidium cornigerum

17432168 (Method 2)

162136057 (Method 2)

Ceratobasidium cereale

3135390 (Method 2)

7407096 (Method 2)

17432169 (Method 2)

17432170 (Method 2)

17432171 (Method 2)

Ceratobasidium sp. CAG1

16565813 (Method 2)

Ceratobasidium sp. AG-Bb

83272308 (Method 2)

Ceratobasidium sp. AG-Ba

121582253 (Method 2)

122703728 (Method 2)

122703729 (Method 2)

216963582 (Method 2)

216963587 (Method 2)

216963593 (Method 2)

216963615 (Method 2)

216963616 (Method 2)

216963619 (Method 2)

307948723 (Method 2)

315452167 (Method 2)

315452168 (Method 2)

315452170 (Method 2)

Ceratobasidium sp. AG-H

16565816 (Method 2)

83272315 (Method 2)

Ceratobasidium sp. AG-D

16565817 (Method 2)

83272310 (Method 2)

Ceratobasidium sp. AG-A

16565819 (Method 2)

70906628 (Method 2)

70906629 (Method 2)

70906631 (Method 2)

70906632 (Method 2)

70906633 (Method 2)

70906634 (Method 2)

70906635 (Method 2)

70906636 (Method 2)

70906637 (Method 2)

70906638 (Method 2)

70906639 (Method 2)

70906640 (Method 2)

70906641 (Method 2)

70906642 (Method 2)

70906643 (Method 2)

70906645 (Method 2)

70906646 (Method 2)

70906647 (Method 2)

70906648 (Method 2)

70906649 (Method 2)

70906650 (Method 2)

70906651 (Method 2)

70906652 (Method 2)

70906653 (Method 2)

83272302 (Method 2)

116710910 (Method 2)

134142853 (Method 2)

154125723 (Method 2)

158347464 (Method 2)

216963612 (Method 2)

216963613 (Method 2)

300079935 (Method 2)

307948742 (Method 2)

307948743 (Method 2)

307948744 (Method 2)

312271004 (Method 2)

312271005 (Method 2)

323650334 (Method 2)

323650335 (Method 2)

Ceratobasidium sp. AG-L

16565820 (Method 2)

83272297 (Method 2)

122703731 (Method 2)

122703732 (Method 2)

219972630 (Method 2)

Ceratobasidium sp. AG-Q

16565822 (Method 2)

83272311 (Method 2)

Ceratobasidium sp. AG-S

27650398 (Method 2)

Ceratobasidium albasitensis

27650332 (Method 2)

27650333 (Method 2)

Ceratobasidium papillatum

27650399 (Method 2)

Ceratobasidium anceps

27650334 (Method 2)

Ceratobasidium angustisporum

27650335 (Method 2)

Ceratobasidium ramicola

27650400 (Method 2)

Ceratobasidium sp. AG-K

42475523 (Method 2)

70906654 (Method 2)

83272306 (Method 2)

122703730 (Method 2)

312271010 (Method 2)

Ceratobasidium sp. AG-C

122703713 (Method 2)

122703714 (Method 2)

Ceratobasidium sp. AG-G

70906622 (Method 2)

70906624 (Method 2)

70906625 (Method 2)

70906626 (Method 2)

70906627 (Method 2)

71842199 (Method 2)

300303968 (Method 2)

312271011 (Method 2)

Ceratobasidium sp. AG-I

70906667 (Method 2)

70906668 (Method 2)

70906669 (Method 2)

83272314 (Method 2)

122703715 (Method 2)

122703716 (Method 2)

Ceratobasidium sp. AG-B(o)

16565818 (Method 2)

70906655 (Method 2)

70906656 (Method 2)

113531198 (Method 2)

312270998 (Method 2)

Ceratobasidium sp. AG-R

27650402 (Method 2)

113531201 (Method 2)

114842924 (Method 2)

114842925 (Method 2)

114842928 (Method 2)

Ceratobasidium sp. CBS 132.82

83272180 (Method 2)

Ceratobasidium sp. CBS 136.82

83272183 (Method 2)

Ceratobasidium sp. CBS 148.54

83272187 (Method 2)

Ceratobasidium sp. CBS 223.51

83272189 (Method 2)

Ceratobasidium sp. YA18

83272293 (Method 2)

Ceratobasidium sp. MLC1

83272294 (Method 2)

Ceratobasidium sp. FJ33.1

83272298 (Method 2)

Ceratobasidium sp. SJ08

83272301 (Method 2)

Ceratobasidium sp. FJ31.4

83272305 (Method 2)

Ceratobasidium sp. FO 38200

99866602 (Method 2)

Ceratobasidium sp. TAR-2006a

113877430 (Method 2)

113877482 (Method 2)

113877558 (Method 2)

113877602 (Method 2)

Ceratobasidium sp. FPUB 168

146186352 (Method 2)

Ceratobasidium sp. UAMH 5443

159138962 (Method 2)

Ceratobasidium sp. R20

179399516 (Method 2)

Ceratobasidium sp. R21

179399517 (Method 2)

Ceratobasidium sp. R36

179399526 (Method 2)

Ceratobasidium sp. R113

179399563 (Method 2)

Ceratobasidium sp. 3334

240936138 (Method 2)

Ceratobasidium sp. RGBAB1

242199725 (Method 2)

Ceratobasidium sp. RGBAB2

242199726 (Method 2)

Ceratobasidium sp. RGDAL1

242199733 (Method 2)

242199746 (Method 2)

Ceratobasidium sp. RGDAL2

242199734 (Method 2)

242199747 (Method 2)

Ceratobasidium sp. RGDAL3

242199735 (Method 2)

242199748 (Method 2)

Ceratobasidium sp. RGKUN1

242199724 (Method 2)

Ceratobasidium sp. RGOLD1

242199731 (Method 2)

242199744 (Method 2)

Ceratobasidium sp. RGOLD2

242199732 (Method 2)

242199745 (Method 2)

Ceratobasidium sp. RGSOR1

242199727 (Method 2)

Ceratobasidium sp. RGSOR2

242199728 (Method 2)

Ceratobasidium sp. RGSOR3

242199729 (Method 2)

Ceratobasidium sp. RGSOR4

242199730 (Method 2)

Ceratobasidium sp. RS

242199736 (Method 2)

Ceratobasidium sp. 0109CI64L1

295809792 (Method 2)

Ceratobasidium sp. DH-C1

299851512 (Method 2)

Ceratobasidium sp. 1 TMS-2011

317383301 (Method 2)

mitosporic Ceratobasidiaceae

Ceratorhiza

Ceratorhiza oryzae-sativae

2281910 (Method 2)

2281911 (Method 2)

2281912 (Method 2)

2281913 (Method 2)

42475522 (Method 2)

83779019 (Method 2)

83779022 (Method 2)

134142854 (Method 2)

158347466 (Method 2)

209975879 (Method 2)

209975884 (Method 2)

224591318 (Method 2)

224591320 (Method 2)

Waitea

Waitea circinata

251734362 (Method 2)

Rhizoctonia zeae

unclassified Ceratobasidiaceae

Ceratobasidiaceae sp. R92

117938169 (Method 2)

Ceratobasidiaceae sp. M152

299810451 (Method 2)

Ceratobasidiaceae sp. M327

299810452 (Method 2)

Ceratobasidiaceae sp. M334

299810453 (Method 2)

environmental samples

uncultured Ceratobasidiaceae

54695061 (Method 2)

54695076 (Method 2)

54695083 (Method 2)

54695084 (Method 2)

54695085 (Method 2)

78459630 (Method 2)

82796509 (Method 2)

82796510 (Method 2)

86212245 (Method 2)

86212247 (Method 2)

150035433 (Method 2)

150035434 (Method 2)

154082242 (Method 2)

219812669 (Method 2)

219812768 (Method 2)

219813249 (Method 2)

219813956 (Method 2)

219813957 (Method 2)

264716434 (Method 2)

264716437 (Method 2)

264716440 (Method 2)

264716441 (Method 2)

264716442 (Method 2)

264716443 (Method 2)

264716444 (Method 2)

264716445 (Method 2)

264716447 (Method 2)

264716448 (Method 2)

264716458 (Method 2)

264716459 (Method 2)

264716463 (Method 2)

264716464 (Method 2)

264716466 (Method 2)

264716467 (Method 2)

264716471 (Method 2)

264716488 (Method 2)

264716492 (Method 2)

264716493 (Method 2)

282722054 (Method 2)

283854256 (Method 2)

299480140 (Method 2)

299810445 (Method 2)

299810447 (Method 2)

299810448 (Method 2)

299810460 (Method 2)

299810480 (Method 2)

299810481 (Method 2)

299810482 (Method 2)

299810483 (Method 2)

299810484 (Method 2)

306846867 (Method 2)

310690059 (Method 2)

310871718 (Method 2)

310871719 (Method 2)

uncultured Ceratobasidium

119887815 (Method 2)

119887817 (Method 2)

154082121 (Method 2)

154082128 (Method 2)

154082129 (Method 2)

154082130 (Method 2)

186908888 (Method 2)

190350702 (Method 2)

194400813 (Method 2)

219968196 (Method 2)

219968231 (Method 2)

219968237 (Method 2)

239923324 (Method 2)

260065655 (Method 2)

260065656 (Method 2)

260177291 (Method 2)

260177294 (Method 2)

298257765 (Method 2)

298257769 (Method 2)

298257770 (Method 2)

298257771 (Method 2)

298257774 (Method 2)

298257775 (Method 2)

298257776 (Method 2)

298257780 (Method 2)

300490560 (Method 2)

306846868 (Method 2)

environmental samples

uncultured Cantharellales

104304709 (Method 2)

unclassified Cantharellales

Cantharellales sp. UAMH 5437

159138961 (Method 2)

Thelephorales

Typhulaceae

Typhula

mitosporic Typhula

Sclerotium

Sclerotium hydrophilum

124257922 (Method 2)

158347469 (Method 2)

158347472 (Method 2)

158347473 (Method 2)

221706463 (Method 2)

221706464 (Method 2)

Sclerotium tuliparum

158442064 (Method 2)

Sclerotium rhizodes

209975881 (Method 2)

209975882 (Method 2)

environmental samples

uncultured Rhizoctonia

73622355 (Method 2)

187961781 (Method 2)

unclassified Basidiomycota

Basidiomycota sp. V218

289655925 (Method 2)

Basidiomycota sp. V412

289655926 (Method 2)

environmental samples

uncultured Basidiomycota

163257897 (Method 2)

254212123 (Method 2)

289547159 (Method 2)

313483157 (Method 2)

uncultured soil basidiomycete

111555214 (Method 2)

111555223 (Method 2)

111555231 (Method 2)

111555233 (Method 2)

111555245 (Method 2)

111555258 (Method 2)

111555259 (Method 2)

111555260 (Method 2)

111555273 (Method 2)

156255573 (Method 2)

219968230 (Method 2)

mycorrhizal samples

vouchered mycorrhizae (Basidiomycota)

221218409 (Method 2)

221218410 (Method 2)

221218411 (Method 2)

221218412 (Method 2)

221218413 (Method 2)

221218414 (Method 2)

221218415 (Method 2)

221218416 (Method 2)

221218417 (Method 2)

221218418 (Method 2)

221218419 (Method 2)

221218420 (Method 2)

221218421 (Method 2)

221218422 (Method 2)

221218423 (Method 2)

221218424 (Method 2)

221218425 (Method 2)

221218426 (Method 2)

221218427 (Method 2)

221218428 (Method 2)

221218429 (Method 2)

221218430 (Method 2)

221218431 (Method 2)

221218432 (Method 2)

221218433 (Method 2)

221218434 (Method 2)

221218435 (Method 2)

221218436 (Method 2)

221218437 (Method 2)

221218438 (Method 2)

221218439 (Method 2)

221218440 (Method 2)

221218441 (Method 2)

221218442 (Method 2)

221218443 (Method 2)

221218444 (Method 2)

221218445 (Method 2)

Annotation Process: HMM annotation
Start: 333
End: 560

If you use the database please cite.