Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 76786575

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 76786575 see NCBI Nucleotide
Accession DQ200923
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Fungi/Metazoa group ; Fungi ; Dikarya ; Basidiomycota ; Agaricomycotina ; Agaricomycetes ; Agaricomycetes incertae sedis ; Russulales ; Bondarzewiaceae ; Bondarzewia ; Bondarzewia montana 
Sequence GTGAAATTCTCAACCCCGTCTTCTTTYTTGAAGAGCGGAGGTTGGACTTGGAGGTCGTTGCCGGTCCTTTTGTGATCGGCTCCTCTGGAATGCATTAGCGAGACCCTTGCGGTGGCGCCTTGGTGTGATAATTGTCTACGCCATGGACGTGCCGCGATTTCATGGGGCGCTCGCTTCGAACCGTCGCAAGACACTTTCATCGAACC
Structure .........((((((((((((((......))))).))).))))))..(((((((.....(((((((.......))))))).)))))))........((((((.(((((((((((.((((.(((((((((....))).)))))).)).))))))))))......)))...))))))((((...(((....))).......))))...
Method 1: RNAfold - direct fold
Energy -73.7 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured fungus see NCBI Taxonomy
257122697 (Method 2) see NCBI Nucleotide
299767743 (Method 2) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetes incertae sedis see NCBI Taxonomy
Polyporales see NCBI Taxonomy
Polyporaceae see NCBI Taxonomy
Polyporus see NCBI Taxonomy
Polyporus squamosus see NCBI Taxonomy
33325953 (Method 2) see NCBI Nucleotide
Russulales see NCBI Taxonomy
Russulaceae see NCBI Taxonomy
Lactarius see NCBI Taxonomy
Lactarius volemus see NCBI Taxonomy
30840875 (Method 2) see NCBI Nucleotide
Bondarzewiaceae see NCBI Taxonomy
Heterobasidion see NCBI Taxonomy
Heterobasidion araucariae see NCBI Taxonomy
397933 (Method 2) see NCBI Nucleotide
Heterobasidion annosum species complex see NCBI Taxonomy
Heterobasidion annosum see NCBI Taxonomy
397926 (Method 2) see NCBI Nucleotide
397927 (Method 2) see NCBI Nucleotide
397928 (Method 2) see NCBI Nucleotide
397929 (Method 2) see NCBI Nucleotide
397930 (Method 2) see NCBI Nucleotide
633200 (Method 2) see NCBI Nucleotide
1225971 (Method 2) see NCBI Nucleotide
1225972 (Method 2) see NCBI Nucleotide
1225973 (Method 2) see NCBI Nucleotide
1225974 (Method 2) see NCBI Nucleotide
9937468 (Method 2) see NCBI Nucleotide
9937469 (Method 2) see NCBI Nucleotide
9937470 (Method 2) see NCBI Nucleotide
13774445 (Method 2) see NCBI Nucleotide
21666883 (Method 2) see NCBI Nucleotide
21666930 (Method 2) see NCBI Nucleotide
59797355 (Method 2) see NCBI Nucleotide
77557445 (Method 2) see NCBI Nucleotide
88854029 (Method 2) see NCBI Nucleotide
220962096 (Method 2) see NCBI Nucleotide
310923501 (Method 2) see NCBI Nucleotide
317445740 (Method 2) see NCBI Nucleotide
Heterobasidion parviporum see NCBI Taxonomy
162296322 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui1 see NCBI Taxonomy
223551548 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui10 see NCBI Taxonomy
223551578 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui105 see NCBI Taxonomy
223551533 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui106 see NCBI Taxonomy
223551536 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui107 see NCBI Taxonomy
223551537 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui110 see NCBI Taxonomy
223551541 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui111 see NCBI Taxonomy
223551542 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui112 see NCBI Taxonomy
223551543 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui114 see NCBI Taxonomy
223551538 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui115 see NCBI Taxonomy
223551544 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui116 see NCBI Taxonomy
223551546 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui117 see NCBI Taxonomy
223551547 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui118 see NCBI Taxonomy
223551545 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui119 see NCBI Taxonomy
223551584 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui121 see NCBI Taxonomy
223551585 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui123 see NCBI Taxonomy
223551586 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui124 see NCBI Taxonomy
223551587 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui13 see NCBI Taxonomy
223551539 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui132 see NCBI Taxonomy
223551549 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui139 see NCBI Taxonomy
223551583 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui14 see NCBI Taxonomy
223551579 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui145 see NCBI Taxonomy
223551553 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui148 see NCBI Taxonomy
223551582 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui149 see NCBI Taxonomy
223551529 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui150 see NCBI Taxonomy
223551530 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui151 see NCBI Taxonomy
223551531 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui16 see NCBI Taxonomy
223551574 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui17 see NCBI Taxonomy
223551575 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui2 see NCBI Taxonomy
223551528 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui22 see NCBI Taxonomy
223551550 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui23 see NCBI Taxonomy
223551535 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui27 see NCBI Taxonomy
223551580 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui5 see NCBI Taxonomy
223551572 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui77 see NCBI Taxonomy
223551532 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui78 see NCBI Taxonomy
223551540 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui8 see NCBI Taxonomy
223551534 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui82 see NCBI Taxonomy
223551576 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui84 see NCBI Taxonomy
223551581 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui87 see NCBI Taxonomy
223551577 (Method 2) see NCBI Nucleotide
Heterobasidion sp. Cui9 see NCBI Taxonomy
223551573 (Method 2) see NCBI Nucleotide
Bondarzewia see NCBI Taxonomy
Bondarzewia berkeleyi see NCBI Taxonomy
223953504 (Method 2) see NCBI Nucleotide
Echinodontiaceae see NCBI Taxonomy
Echinodontium see NCBI Taxonomy
Echinodontium tinctorium see NCBI Taxonomy
33324404 (Method 2) see NCBI Nucleotide
Agaricomycetidae see NCBI Taxonomy
Agaricales see NCBI Taxonomy
unclassified Agaricales see NCBI Taxonomy
Agaricales sp. HK-S179 see NCBI Taxonomy
74197597 (Method 2) see NCBI Nucleotide
unclassified Basidiomycota see NCBI Taxonomy
basidiomycete sp. OS-S135 see NCBI Taxonomy
78644002 (Method 2) see NCBI Nucleotide
basidiomycete sp. OS-S137 see NCBI Taxonomy
78644004 (Method 2) see NCBI Nucleotide
basidiomycete sp. OS-S26 see NCBI Taxonomy
78644017 (Method 2) see NCBI Nucleotide
basidiomycete sp. OS-S27 see NCBI Taxonomy
78644018 (Method 2) see NCBI Nucleotide
basidiomycete sp. OS-S28 see NCBI Taxonomy
78644019 (Method 2) see NCBI Nucleotide
basidiomycete sp. OS-S34 see NCBI Taxonomy
78644025 (Method 2) see NCBI Nucleotide
Annotation Process: Mixed HMM and Genbank annotation
Start: 328
End: 533

If you use the database please cite.