Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 55820070

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 55820070 see NCBI Nucleotide
Accession AY593855
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Fungi/Metazoa group ; Fungi ; Dikarya ; Basidiomycota ; Agaricomycotina ; Agaricomycetes ; Agaricomycetes incertae sedis ; Polyporales ; Ganodermataceae ; Ganoderma ; Ganoderma gibbosum 
Sequence ATGAAATMTTCAATCTACAAACTTCTTATGGGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGTCCCTTTACAGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTTGTCGGTGTGATAATGTCTACGCCGCGACCGTGAAGCGTGTTTGGGCGAGCTTCTAACCGTCTCGTTACAGAGACAACTTTTATGACCTCTGA
Structure ....((..(((((((((((((((((....)))))))))))).))))).))(((((...(((((..(((....)))))))).)))))..........((((((..(((.(((....(((.(((.(((((((((...))).))))))))))))....))).....))))))))).......(((((......)))))..................
Method 1: RNAfold - direct fold
Energy -60.2 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured fungus see NCBI Taxonomy
226348989 (Method 2) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetes incertae sedis see NCBI Taxonomy
Polyporales see NCBI Taxonomy
Ganodermataceae see NCBI Taxonomy
Ganoderma see NCBI Taxonomy
Ganoderma lucidum see NCBI Taxonomy
474126 (Method 2) see NCBI Nucleotide
474130 (Method 2) see NCBI Nucleotide
474132 (Method 2) see NCBI Nucleotide
5764512 (Method 2) see NCBI Nucleotide
5764532 (Method 2) see NCBI Nucleotide
38455347 (Method 2) see NCBI Nucleotide
220966584 (Method 2) see NCBI Nucleotide
281199953 (Method 2) see NCBI Nucleotide
281199954 (Method 2) see NCBI Nucleotide
281199955 (Method 2) see NCBI Nucleotide
291586609 (Method 2) see NCBI Nucleotide
291586610 (Method 2) see NCBI Nucleotide
291586611 (Method 2) see NCBI Nucleotide
291586612 (Method 2) see NCBI Nucleotide
296427694 (Method 2) see NCBI Nucleotide
296427695 (Method 2) see NCBI Nucleotide
296427696 (Method 2) see NCBI Nucleotide
296427697 (Method 2) see NCBI Nucleotide
296427698 (Method 2) see NCBI Nucleotide
296427699 (Method 2) see NCBI Nucleotide
309261060 (Method 2) see NCBI Nucleotide
323651449 (Method 2) see NCBI Nucleotide
323651450 (Method 2) see NCBI Nucleotide
Ganoderma applanatum see NCBI Taxonomy
281199949 (Method 2) see NCBI Nucleotide
281199950 (Method 2) see NCBI Nucleotide
298354052 (Method 2) see NCBI Nucleotide
Ganoderma adspersum see NCBI Taxonomy
474113 (Method 2) see NCBI Nucleotide
117671327 (Method 2) see NCBI Nucleotide
117671328 (Method 2) see NCBI Nucleotide
117671329 (Method 2) see NCBI Nucleotide
158934556 (Method 2) see NCBI Nucleotide
158934559 (Method 2) see NCBI Nucleotide
158934560 (Method 2) see NCBI Nucleotide
164514094 (Method 2) see NCBI Nucleotide
164514095 (Method 2) see NCBI Nucleotide
164514096 (Method 2) see NCBI Nucleotide
164514097 (Method 2) see NCBI Nucleotide
Ganoderma australe see NCBI Taxonomy
42661449 (Method 2) see NCBI Nucleotide
42661451 (Method 2) see NCBI Nucleotide
62275829 (Method 2) see NCBI Nucleotide
62275830 (Method 2) see NCBI Nucleotide
62275831 (Method 2) see NCBI Nucleotide
165941427 (Method 2) see NCBI Nucleotide
257479975 (Method 2) see NCBI Nucleotide
257479976 (Method 2) see NCBI Nucleotide
257479977 (Method 2) see NCBI Nucleotide
257479978 (Method 2) see NCBI Nucleotide
257479979 (Method 2) see NCBI Nucleotide
257479980 (Method 2) see NCBI Nucleotide
257479981 (Method 2) see NCBI Nucleotide
257479982 (Method 2) see NCBI Nucleotide
281199951 (Method 2) see NCBI Nucleotide
317445736 (Method 2) see NCBI Nucleotide
Ganoderma gibbosum see NCBI Taxonomy
474123 (Method 2) see NCBI Nucleotide
55820069 (Method 2) see NCBI Nucleotide
55820071 (Method 2) see NCBI Nucleotide
55820072 (Method 2) see NCBI Nucleotide
55820073 (Method 2) see NCBI Nucleotide
162136045 (Method 2) see NCBI Nucleotide
162136046 (Method 2) see NCBI Nucleotide
162136063 (Method 2) see NCBI Nucleotide
162285941 (Method 2) see NCBI Nucleotide
162285942 (Method 2) see NCBI Nucleotide
195979285 (Method 2) see NCBI Nucleotide
212658106 (Method 2) see NCBI Nucleotide
221145754 (Method 2) see NCBI Nucleotide
Ganoderma lobatum see NCBI Taxonomy
474128 (Method 2) see NCBI Nucleotide
5764486 (Method 2) see NCBI Nucleotide
5764490 (Method 2) see NCBI Nucleotide
5764519 (Method 2) see NCBI Nucleotide
5764521 (Method 2) see NCBI Nucleotide
Ganoderma tsugae see NCBI Taxonomy
474149 (Method 2) see NCBI Nucleotide
474155 (Method 2) see NCBI Nucleotide
474157 (Method 2) see NCBI Nucleotide
Ganoderma japonicum see NCBI Taxonomy
55820078 (Method 2) see NCBI Nucleotide
55820079 (Method 2) see NCBI Nucleotide
281199952 (Method 2) see NCBI Nucleotide
Ganoderma sinense see NCBI Taxonomy
309261061 (Method 2) see NCBI Nucleotide
309261062 (Method 2) see NCBI Nucleotide
Ganoderma lipsiense see NCBI Taxonomy
5764480 (Method 2) see NCBI Nucleotide
5764516 (Method 2) see NCBI Nucleotide
Ganoderma tornatum see NCBI Taxonomy
5764478 (Method 2) see NCBI Nucleotide
5764482 (Method 2) see NCBI Nucleotide
5764515 (Method 2) see NCBI Nucleotide
5764517 (Method 2) see NCBI Nucleotide
Ganoderma sp. BAFC2407 see NCBI Taxonomy
5764484 (Method 2) see NCBI Nucleotide
5764518 (Method 2) see NCBI Nucleotide
Ganoderma sp. BAFC2557 see NCBI Taxonomy
5764498 (Method 2) see NCBI Nucleotide
5764525 (Method 2) see NCBI Nucleotide
Ganoderma sp. JM97/56 see NCBI Taxonomy
13897639 (Method 2) see NCBI Nucleotide
Ganoderma sp. JM98/1 see NCBI Taxonomy
13897640 (Method 2) see NCBI Nucleotide
Ganoderma sp. CBS175.30 see NCBI Taxonomy
13897641 (Method 2) see NCBI Nucleotide
Ganoderma sp. PKB96/332 see NCBI Taxonomy
13897644 (Method 2) see NCBI Nucleotide
Ganoderma sp. JM98/19 see NCBI Taxonomy
13897660 (Method 2) see NCBI Nucleotide
Ganoderma sp. ME-GAN24 see NCBI Taxonomy
13897672 (Method 2) see NCBI Nucleotide
Ganoderma sp. JMCR.142 see NCBI Taxonomy
13897677 (Method 2) see NCBI Nucleotide
Ganoderma sp. LXT.6 see NCBI Taxonomy
13897729 (Method 2) see NCBI Nucleotide
Ganoderma sp. MUCL27886 see NCBI Taxonomy
13897730 (Method 2) see NCBI Nucleotide
Ganoderma sp. wb595 see NCBI Taxonomy
21666824 (Method 2) see NCBI Nucleotide
Ganoderma sp. wb249 see NCBI Taxonomy
21666945 (Method 2) see NCBI Nucleotide
Ganoderma sp. SP11 see NCBI Taxonomy
158934557 (Method 2) see NCBI Nucleotide
Ganoderma sp. SP16 see NCBI Taxonomy
158934558 (Method 2) see NCBI Nucleotide
Ganoderma sp. UK 250593.1 see NCBI Taxonomy
117671326 (Method 2) see NCBI Nucleotide
Ganoderma sp. ITA 35 see NCBI Taxonomy
117671330 (Method 2) see NCBI Nucleotide
Ganoderma aff. steyaertanum C16722 see NCBI Taxonomy
165941431 (Method 2) see NCBI Nucleotide
Ganoderma ramosissimum see NCBI Taxonomy
195979290 (Method 2) see NCBI Nucleotide
218454103 (Method 2) see NCBI Nucleotide
Ganoderma fulvellum see NCBI Taxonomy
218454064 (Method 2) see NCBI Nucleotide
Ganoderma lucidum/Ganoderma lucidum fusant see NCBI Taxonomy
220966581 (Method 2) see NCBI Nucleotide
220966596 (Method 2) see NCBI Nucleotide
220966604 (Method 2) see NCBI Nucleotide
Polyporaceae see NCBI Taxonomy
Polyporus see NCBI Taxonomy
Polyporus squamosus see NCBI Taxonomy
29150734 (Method 2) see NCBI Nucleotide
33325327 (Method 2) see NCBI Nucleotide
33325341 (Method 2) see NCBI Nucleotide
33325342 (Method 2) see NCBI Nucleotide
33325343 (Method 2) see NCBI Nucleotide
33325344 (Method 2) see NCBI Nucleotide
33325345 (Method 2) see NCBI Nucleotide
33325346 (Method 2) see NCBI Nucleotide
81345668 (Method 2) see NCBI Nucleotide
317445760 (Method 2) see NCBI Nucleotide
319748539 (Method 2) see NCBI Nucleotide
Perenniporia see NCBI Taxonomy
Perenniporia medulla-panis see NCBI Taxonomy
237784360 (Method 2) see NCBI Nucleotide
Perenniporia sp. MUCL 47876 see NCBI Taxonomy
237784362 (Method 2) see NCBI Nucleotide
Favolus see NCBI Taxonomy
Favolus squamosus see NCBI Taxonomy
226346582 (Method 2) see NCBI Nucleotide
Coriolaceae see NCBI Taxonomy
Trametes see NCBI Taxonomy
Trametes sp. UFMGCB 1984 see NCBI Taxonomy
323361118 (Method 2) see NCBI Nucleotide
Datronia see NCBI Taxonomy
Datronia mollis see NCBI Taxonomy
33325312 (Method 2) see NCBI Nucleotide
Postia see NCBI Taxonomy
Postia sericeomollis see NCBI Taxonomy
3688519 (Method 2) see NCBI Nucleotide
unclassified Basidiomycota see NCBI Taxonomy
basidiomycete sp. LC1 see NCBI Taxonomy
51035307 (Method 2) see NCBI Nucleotide
basidiomycete sp. CB2 see NCBI Taxonomy
51035311 (Method 2) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 390
End: 602

If you use the database please cite.