Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 11120117

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 11120117 see NCBI Nucleotide
Accession AF287676
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Viridiplantae ; Streptophyta ; Streptophytina ; Embryophyta ; Tracheophyta ; Euphyllophyta ; Spermatophyta ; Magnoliophyta ; eudicotyledons ; core eudicotyledons ; rosids ; fabids ; Fabales ; Fabaceae ; Papilionoideae ; Crotalarieae ; Lotononis ; Lotononis lotononoides 
Sequence GCCCATCGTTGCCCCAGTGCCTTGGCCTCGTGCTAGGCACCGAATGGGGCGAATGCTGGCTTCCCGCGAGCAATGCCTCACGGTTGGTTGAAAACTGAGTCCGTGGTGGAGGGCGCCGTGATGGATGGTGGTTGAGTAAAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCGGATTTGCGACTCTATGGCCCATGGGCGTCTTTTGGTCGCCCAAGACGGGA
Structure ...(((..((((((((((((((.(((.....)))))))))....)))))))))))..((((..(((.((((...).))).)))..))))....(.((((((((((((((.(((.((((((.(((.((((..((((((....)))))).)))).))))))).))..)))))))))....)).))))).))..(((.((((((.((...)).))))))....))).
Method 2: Homology modeled
Energy -77.5 kcal/mol
Model 25070791
Alignment 
Sbjct: GCACATCGTTGCCCCAATGCCTTGGCCATGTGCTAGGCACCGAGTGGGGCGAATGTTGGCTTCCCGCGAGCAGTGTCTCACGGTTGGTTGAAAACTGAGTCCGTGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTTAAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGATTTGCGACTCTGTGACCCATGGGGGTCTGTTGGGCCCCTAAGACGGGA
       ..((((..((((((((.(((((.(((.....)))))))).....)))))))))))).((((..(((.(((......))).)))..))))....((.(((((((((((((.(((.((((((..((.((((...(((((....)))))..)))).)).)))).))..)))))))))....)).))))).))..(((.(((((((((...)))))))))....))).
Query: GCCCATCGTTGCCCCAGTGCCTTGGCCTCGTGCTAGGCACCGAATGGGGCGAATGCTGGCTTCCCGCGAGCAATGCCTCACGGTTGGTTGAAAACTGAGTCCGTGGTGGAGGGCGCCGTGATGGATGGTGGTTGAGTAAAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCGGATTTGCGACTCTATGGCCCATGGGCGTCTTTTGGTCGCCCAAGACGGGA
       ...(((..((((((((.(((((.(((.....)))))))).....)))))))))))..((((..(((.(((......))).)))..))))....(..(((((((((((((.(((.((((((..((.((((...(((((....)))))..)))).)).)))).))..)))))))))....)).)))))..)..(((.((((((.((...)).))))))....))).
 CBCs: _______________________________________________________________________________________________________________________________________________________________________________________________________(___________)____________
HCBCs: _______________________________________________________________________________________________________(_____________________________________________________________________)______________________(_________________)_________
Transferred percentage of helices I: 95
II: 100
III: 97.143
IV: 91.667
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Viridiplantae see NCBI Taxonomy
Streptophyta see NCBI Taxonomy
Streptophytina see NCBI Taxonomy
Embryophyta see NCBI Taxonomy
Tracheophyta see NCBI Taxonomy
Euphyllophyta see NCBI Taxonomy
Spermatophyta see NCBI Taxonomy
Magnoliophyta see NCBI Taxonomy
eudicotyledons see NCBI Taxonomy
core eudicotyledons see NCBI Taxonomy
rosids see NCBI Taxonomy
fabids see NCBI Taxonomy
Fabales see NCBI Taxonomy
Fabaceae see NCBI Taxonomy
Papilionoideae see NCBI Taxonomy
Crotalarieae see NCBI Taxonomy
Lotononis see NCBI Taxonomy
Lotononis lotononoides see NCBI Taxonomy
169260515 (Method 3) see NCBI Nucleotide
Lotononis carnosa see NCBI Taxonomy
169260493 (Method 3) see NCBI Nucleotide
Lotononis cf. curtii Van Wyk et al. 4172 see NCBI Taxonomy
169260508 (Method 3) see NCBI Nucleotide
Lotononis densa see NCBI Taxonomy
169260485 (Method 3) see NCBI Nucleotide
Lotononis densa subsp. leucoclada see NCBI Taxonomy
169260485 (Method 3) see NCBI Nucleotide
Lotononis divaricata see NCBI Taxonomy
169260481 (Method 3) see NCBI Nucleotide
Lotononis elongata see NCBI Taxonomy
169260514 (Method 3) see NCBI Nucleotide
Lotononis exstipulata see NCBI Taxonomy
169260489 (Method 3) see NCBI Nucleotide
Lotononis filiformis see NCBI Taxonomy
169260487 (Method 3) see NCBI Nucleotide
Lotononis hirsuta see NCBI Taxonomy
169260572 (Method 3) see NCBI Nucleotide
169260573 (Method 3) see NCBI Nucleotide
169260574 (Method 3) see NCBI Nucleotide
Lotononis involucrata see NCBI Taxonomy
169260498 (Method 3) see NCBI Nucleotide
169260499 (Method 3) see NCBI Nucleotide
Lotononis involucrata subsp. peduncularis see NCBI Taxonomy
169260499 (Method 3) see NCBI Nucleotide
Lotononis leptoloba see NCBI Taxonomy
169260497 (Method 3) see NCBI Nucleotide
Lotononis maximiliani see NCBI Taxonomy
169260492 (Method 3) see NCBI Nucleotide
Lotononis meyeri see NCBI Taxonomy
169260504 (Method 3) see NCBI Nucleotide
Lotononis prostrata see NCBI Taxonomy
169260501 (Method 3) see NCBI Nucleotide
Lotononis pulchella see NCBI Taxonomy
169260478 (Method 3) see NCBI Nucleotide
Lotononis pungens see NCBI Taxonomy
169260483 (Method 3) see NCBI Nucleotide
169260500 (Method 3) see NCBI Nucleotide
Lotononis rigida see NCBI Taxonomy
169260484 (Method 3) see NCBI Nucleotide
Lotononis sabulosa see NCBI Taxonomy
169260513 (Method 3) see NCBI Nucleotide
Lotononis sericophylla see NCBI Taxonomy
169260482 (Method 3) see NCBI Nucleotide
169260496 (Method 3) see NCBI Nucleotide
Lotononis solitudinis see NCBI Taxonomy
169260516 (Method 3) see NCBI Nucleotide
Lotononis stricta see NCBI Taxonomy
169260486 (Method 3) see NCBI Nucleotide
Lotononis subulata see NCBI Taxonomy
169260517 (Method 3) see NCBI Nucleotide
Thermopsideae see NCBI Taxonomy
Baptisia see NCBI Taxonomy
Baptisia australis see NCBI Taxonomy
27447257 (Method 3) see NCBI Nucleotide
Piptanthus see NCBI Taxonomy
Piptanthus leiocarpus see NCBI Taxonomy
27447254 (Method 3) see NCBI Nucleotide
Ammopiptanthus see NCBI Taxonomy
Ammopiptanthus nanus see NCBI Taxonomy
6707496 (Method 3) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 376
End: 599

If you use the database please cite.