Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 210076557

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 210076557 see NCBI Nucleotide
Accession FJ374875
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Agaricomycetes Agaricomycetes incertae sedis Polyporales Ganodermataceae Ganoderma Ganoderma pseudoferreum 
Sequence ATGAAATCTTCAACCTACAAGCTTTTGTGGTTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCATTCTCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGTGGATCGGCTCTCGGTGTGATAACATCTACGCCGCGACCGTGAAGCGTTTGGCGAGCTTCTAATCGTCTCAGTTGAAGACAGCTTTATGACCTCTGA
Structure ........(((((((((((((((.....)).)))))))).)))))...(((((...((((((((...).))))))).)))))........((((...(.((((.(((...((((.((.(((((((((...))).)))))).))))).)..)))...)).)).)..))))..((((.(((((....)))))..).)))......
Method 2: Homology modeled
Energy -46.7 kcal/mol
Model 296427683
Alignment
Sbjct: ATGAAATCTTCAACCTGCAAGCTTTTGTGG-TTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCGTTCTTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCAGTGTGATAAAATCTACGCTGCGACCGTGAAGCGTTTGGTAGCCTTCTAACCGTCTCAGTTGGAGACAACTTTATGACCTCTGA
       ........(((((((((((((((.....))-)))))))).)))))...(((((...(((((((......))))))).)))))........((((...((((((.(((....(((.((.(((((((((...))).)))))).)))))....)))...)).))))..))))..(((..(((((....)))))....)))......
Query: ATGAAATCTTCAACCTACAAGCTTTTGTGGTTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCATTCTCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGTGGATCGGCTCTCGGTGTGATAACATCTACGCCGCGACCGTGAAGCGTTTGGCGAGCTTCTAATCGTCTCAGTTGAAGACAGCTTTATGACCTCTGA
       ........(((((((((((((((.....)).)))))))).)))))...(((((...(((((((......))))))).)))))........((((...(.((((.(((....(((.((.(((((((((...))).)))))).)))))....)))...)).)).)..))))..(((..(((((....)))))....)))......
 CBCs: _______________________________________________________________________________________________________________________(__________________)________________________________________________________________
HCBCs: ________________(__________________)_______________________________________________________________((_____(___________________________________________)________))_________________(________)_______________
Transferred percentage of helices I: 100
II: 100
III: 96.296
IV: 100
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured fungus see NCBI Taxonomy
284936625 (Method 3) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetes incertae sedis see NCBI Taxonomy
Polyporales see NCBI Taxonomy
Ganodermataceae see NCBI Taxonomy
Ganoderma see NCBI Taxonomy
Ganoderma lucidum see NCBI Taxonomy
853935 (Method 3) see NCBI Nucleotide
853936 (Method 3) see NCBI Nucleotide
853937 (Method 3) see NCBI Nucleotide
853938 (Method 3) see NCBI Nucleotide
853939 (Method 3) see NCBI Nucleotide
853942 (Method 3) see NCBI Nucleotide
157777861 (Method 3) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 384
End: 586

If you use the database please cite.