Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 215433632

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 215433632 see NCBI Nucleotide
Accession EU862216
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Agaricomycetes Agaricomycetes incertae sedis Cantharellales Clavulinaceae Clavulina Clavulina cristata 
Sequence GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGTTTCACAGATTGTRCAATCTGTGTTCCACATTCAGCTTGACCTCGA
Structure (((((..((((((((.(((((((((..(...))))))..).))).))))).....))).))))).(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))..................
Method 2: Homology modeled
Energy -35.7 kcal/mol
Model 219930312
Alignment
Sbjct: GTGAAA-TCCTCAAGCTTGGATGGTTT-----TCCGT--CTTAAGCTTGG-TATTGGGCTTTGCTGTGCCTTTCGTTGGAACAGCTGGCCTTAAAAGCATTAGCTGATCCTCATGTGGCATTGGTTCTACTCAGCGTGATAATGATATTGACCGCTGGGGACATCTTTCTAGATGGCCAATTCTCTCATCTGGGTTGCTTCTAATTTGGCTTTGACAGATTCTGATCAGAACTGTTTTGCCCTTCTGTTTTGA------
       (((((.-(((((((((((((((((...-----.))))--).)))))))))-....))).))))).(((((...(((.(((.((((((((.......))..)))))).)))..))).))))).(((...((((((.((((....((.((((.((((((((((....))))))).))).))))))..)))))))))).)))........(((...(((((.((((....)))))))))..)))............------
Query: GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGT-CTGATCGCTGAGGACATCTTTTGGGATGGCCAG--CTCTCATTTGGGTTGCTTCTAAACTTGGTTTCACAGATT---GTRCAATCTGTGTTCCACATTCAGCTTGACCTCGA
       (((((..((((((((.((((((((.........))))..).))).))))).....))).))))).(((((...(((.((..((((((((.......))..))))))..))..))).))))).(((...((((((.((((.......-(((.(((((.((((....)))).)).))).)))--...)))))))))).)))........(((...(((((..(---.....).)))))..)))..................
 CBCs: ___________________________________________________________________________________________________________________________________________________(_________(__________)__________)___________________________(_(___(_____________________)__)_)__________________
HCBCs: _(______(_______(__________________________)____________)_____)__(__(_____((______(___(_____________)___)_______))___)__)____________(_________________(___(______________)____)_____________)_____________________________________________________________________
Transferred percentage of helices I: 95.455
II: 94.737
III: 86.207
IV: 75
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured soil fungus see NCBI Taxonomy
197112180 (Method 2) see NCBI Nucleotide
197112189 (Method 2) see NCBI Nucleotide
197112192 (Method 2) see NCBI Nucleotide
197112196 (Method 2) see NCBI Nucleotide
197112199 (Method 2) see NCBI Nucleotide
197112206 (Method 2) see NCBI Nucleotide
197112209 (Method 2) see NCBI Nucleotide
197112214 (Method 2) see NCBI Nucleotide
197112219 (Method 2) see NCBI Nucleotide
197112271 (Method 2) see NCBI Nucleotide
197112341 (Method 2) see NCBI Nucleotide
197112344 (Method 2) see NCBI Nucleotide
197112378 (Method 2) see NCBI Nucleotide
197112379 (Method 2) see NCBI Nucleotide
197112380 (Method 2) see NCBI Nucleotide
197112381 (Method 2) see NCBI Nucleotide
197112382 (Method 2) see NCBI Nucleotide
197112383 (Method 2) see NCBI Nucleotide
197112386 (Method 2) see NCBI Nucleotide
197112387 (Method 2) see NCBI Nucleotide
197112389 (Method 2) see NCBI Nucleotide
197112391 (Method 2) see NCBI Nucleotide
197112392 (Method 2) see NCBI Nucleotide
197112393 (Method 2) see NCBI Nucleotide
197112399 (Method 2) see NCBI Nucleotide
197112401 (Method 2) see NCBI Nucleotide
197112405 (Method 2) see NCBI Nucleotide
197112411 (Method 2) see NCBI Nucleotide
197112412 (Method 2) see NCBI Nucleotide
197112413 (Method 2) see NCBI Nucleotide
197112414 (Method 2) see NCBI Nucleotide
197112416 (Method 2) see NCBI Nucleotide
197112417 (Method 2) see NCBI Nucleotide
197112418 (Method 2) see NCBI Nucleotide
197112419 (Method 2) see NCBI Nucleotide
197112421 (Method 2) see NCBI Nucleotide
197112422 (Method 2) see NCBI Nucleotide
197112477 (Method 2) see NCBI Nucleotide
197112479 (Method 2) see NCBI Nucleotide
197112480 (Method 2) see NCBI Nucleotide
197112481 (Method 2) see NCBI Nucleotide
197112483 (Method 2) see NCBI Nucleotide
197112484 (Method 2) see NCBI Nucleotide
197112487 (Method 2) see NCBI Nucleotide
197112492 (Method 2) see NCBI Nucleotide
197112493 (Method 2) see NCBI Nucleotide
197112497 (Method 2) see NCBI Nucleotide
197112500 (Method 2) see NCBI Nucleotide
197112501 (Method 2) see NCBI Nucleotide
197112502 (Method 2) see NCBI Nucleotide
197112503 (Method 2) see NCBI Nucleotide
197112504 (Method 2) see NCBI Nucleotide
197112507 (Method 2) see NCBI Nucleotide
197112511 (Method 2) see NCBI Nucleotide
197112514 (Method 2) see NCBI Nucleotide
197112516 (Method 2) see NCBI Nucleotide
197112517 (Method 2) see NCBI Nucleotide
197112522 (Method 2) see NCBI Nucleotide
197112524 (Method 2) see NCBI Nucleotide
197112525 (Method 2) see NCBI Nucleotide
197112530 (Method 2) see NCBI Nucleotide
197112549 (Method 2) see NCBI Nucleotide
197112558 (Method 2) see NCBI Nucleotide
197112574 (Method 2) see NCBI Nucleotide
197112600 (Method 2) see NCBI Nucleotide
197112618 (Method 2) see NCBI Nucleotide
197112624 (Method 2) see NCBI Nucleotide
197112681 (Method 2) see NCBI Nucleotide
197112682 (Method 2) see NCBI Nucleotide
197112851 (Method 2) see NCBI Nucleotide
uncultured fungus see NCBI Taxonomy
244538350 (Method 2) see NCBI Nucleotide
302126298 (Method 2) see NCBI Nucleotide
306030542 (Method 2) see NCBI Nucleotide
313761460 (Method 3) see NCBI Nucleotide
313761461 (Method 3) see NCBI Nucleotide
313761468 (Method 3) see NCBI Nucleotide
313761469 (Method 3) see NCBI Nucleotide
313761477 (Method 3) see NCBI Nucleotide
313761478 (Method 3) see NCBI Nucleotide
313761482 (Method 3) see NCBI Nucleotide
uncultured ectomycorrhizal fungus see NCBI Taxonomy
52353918 (Method 3) see NCBI Nucleotide
78191190 (Method 2) see NCBI Nucleotide
78191197 (Method 2) see NCBI Nucleotide
145207490 (Method 2) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetes incertae sedis see NCBI Taxonomy
Cantharellales see NCBI Taxonomy
Clavulinaceae see NCBI Taxonomy
Clavulina see NCBI Taxonomy
Clavulina cristata see NCBI Taxonomy
31745598 (Method 3) see NCBI Nucleotide
61657549 (Method 2) see NCBI Nucleotide
147742855 (Method 3) see NCBI Nucleotide
215433622 (Method 2) see NCBI Nucleotide
215433635 (Method 2) see NCBI Nucleotide
215433639 (Method 2) see NCBI Nucleotide
215433644 (Method 2) see NCBI Nucleotide
Clavulina cinerea see NCBI Taxonomy
13398477 (Method 2) see NCBI Nucleotide
157057268 (Method 2) see NCBI Nucleotide
215433625 (Method 2) see NCBI Nucleotide
Clavulina cf. cristata src75 see NCBI Taxonomy
115605487 (Method 3) see NCBI Nucleotide
Clavulina cf. cinerea UBCOGTR0443s see NCBI Taxonomy
189306994 (Method 2) see NCBI Nucleotide
Clavulina cf. cristata O 65398 see NCBI Taxonomy
215433621 (Method 2) see NCBI Nucleotide
Clavulina cf. cinerea BIO 10296 see NCBI Taxonomy
215433630 (Method 2) see NCBI Nucleotide
Clavulina sp. B203 see NCBI Taxonomy
311334610 (Method 3) see NCBI Nucleotide
Clavulina sp. EMF53 see NCBI Taxonomy
323320654 (Method 2) see NCBI Nucleotide
environmental samples see NCBI Taxonomy
uncultured Clavulina see NCBI Taxonomy
189306935 (Method 2) see NCBI Nucleotide
190682974 (Method 3) see NCBI Nucleotide
204306505 (Method 2) see NCBI Nucleotide
225032891 (Method 2) see NCBI Nucleotide
229892678 (Method 2) see NCBI Nucleotide
291337370 (Method 2) see NCBI Nucleotide
291337483 (Method 2) see NCBI Nucleotide
310690060 (Method 2) see NCBI Nucleotide
310751971 (Method 2) see NCBI Nucleotide
uncultured Clavulinaceae see NCBI Taxonomy
91199891 (Method 2) see NCBI Nucleotide
194045541 (Method 3) see NCBI Nucleotide
225007805 (Method 2) see NCBI Nucleotide
environmental samples see NCBI Taxonomy
uncultured Basidiomycota see NCBI Taxonomy
63408656 (Method 2) see NCBI Nucleotide
63408716 (Method 2) see NCBI Nucleotide
63408736 (Method 2) see NCBI Nucleotide
Annotation Process: Mixed HMM and Genbank annotation
Start: 362
End: 614

If you use the database please cite.