Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 34979722

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 34979722 see NCBI Nucleotide
Accession AY320290
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Metazoa Eumetazoa Cnidaria Anthozoa Hexacorallia Scleractinia Fungiina Poritidae Porites Porites lobata 
Sequence GGATTTTATCGAACGCGCATGACTTGACTGACTCGTGTGCGGTATTGAGGTGTCACGGCGTGTTAAAGTTGAATCGCCGTGTCCCTTGAAGGGCAGCAGCATTGGACTCGCATTCTCTATGGAAACTTGAGTGCGAAGGCTAAAGATAATATTTTCCTTCGCCCAAAAAACCAATAGCAGACGGTCCCAATAGCTGAGACAAACAAAGCGGTGACAATAAATATCCAAAAAATCTTGA
Structure .............(((((((((.((....)).)))))))))...((((((.(.(((((((.((((....))).))))))))).)))))).......(((((((((((.((...(((((((((....(((.(.(((((((..(((..(...)))).)))))))))))....)).)))).))))))).))))).)))).............(((((...)...)))).............
Method 2: Homology modeled
Energy -48.1 kcal/mol
Model 225638481
Alignment
Sbjct: -------------CGCGCATGACTTGACTGAGTCGTGTGCGGTATTGAGGTGTCACGGCGTGTTAAAGTTGAATCGCCGTGTCCCTTGAAGGGCAGCAGCATTGGACTCGCATTCTCTATGGAAACTTGAGTGCGAAGGCTAAAGATACTATTTTCCTTCGCCCAAAAAACCAATAGCAGACGGTCCCAATAGCTGAGACAAACAAAGCGGTGACAATAAACATCCAAAAA-------
       -------------((((((((((((....))))))))))))...((((((...(((((((..(((....)))..)))))))..)))))).......(((((((((((.((...(((((((((....(((...(((((((..(((.......))).))))))).)))....)).)))).))))))).))))).)))).............((((........))))......-------
Query: GGATTTTATCGAACGCGCATGACTTGACTGACTCGTGTGCGGTATTGAGGTGTCACGGCGTGTTAAAGTTGAATCGCCGTGTCCCTTGAAGGGCAGCAGCATTGGACTCGCATTCTCTATGGAAACTTGAGTGCGAAGGCTAAAGATAATATTTTCCTTCGCCCAAAAAACCAATAGCAGACGGTCCCAATAGCTGAGACAAACAAAGCGGTGACAATAAATATCCAAAAAATCTTGA
       .............(((((((((.((....)).)))))))))...((((((...(((((((..(((....)))..)))))))..)))))).......(((((((((((.((...(((((((((....(((...(((((((..(((.......))).))))))).)))....)).)))).))))))).))))).)))).............((((........)))).............
 CBCs: ______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
HCBCs: ____________________________________________________________________________________________________________________________________________________________________________________________________________________(________)________________
Transferred percentage of helices I: 91.667
II: 100
III: 100
IV: 100
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Metazoa see NCBI Taxonomy
Eumetazoa see NCBI Taxonomy
Cnidaria see NCBI Taxonomy
Anthozoa see NCBI Taxonomy
Hexacorallia see NCBI Taxonomy
Scleractinia see NCBI Taxonomy
Fungiina see NCBI Taxonomy
Poritidae see NCBI Taxonomy
Porites see NCBI Taxonomy
Porites rus see NCBI Taxonomy
225638537 (Method 3) see NCBI Nucleotide
225638538 (Method 3) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 366
End: 603

If you use the database please cite.