Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 4321160

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 4321160 see NCBI Nucleotide
Accession AF007473
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Viridiplantae ; Streptophyta ; Streptophytina ; Embryophyta ; Tracheophyta ; Euphyllophyta ; Spermatophyta ; Magnoliophyta ; eudicotyledons ; core eudicotyledons ; rosids ; fabids ; Fabales ; Fabaceae ; Papilionoideae ; Genisteae ; Lupinus ; Lupinus bracteolaris 
Sequence GCACATCGTTGCCCCCGTGCCTTGGCCACGTGCTAGGCACCAAGCGGGGCGAATGTTGGCTTCCCGCGAGCAATGTCTCACGGTTGGTTGAAAATCGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTTAAAGCTCGAGACCGATCGTGCGAGTCACCCCCACCAGCTTTGCGACTCTTTGACCCATGGGGGTCTGTTGGCCTCCTAATACGGGAACCTCAGG
Structure ((.((.((((((((((((((((.(((.....)))))))))...).))))))).)).))))...(((.(((.(...)))).)))..(((((((....(((((((((((((.(((.((((((.(((.((((..((((((....))))).))))).))))))).))..)))))))).))...).))))))))))))..(((((.((((((((...)).)..)))))..)))))..
Method 2: Homology modeled
Energy -72.6 kcal/mol
Model 4321165
Alignment 
Sbjct: GCACATCGTTGCCCCCGTGCCTTGGCCACGTGCCAGGCACGAAGCGGGGCGAATGTTGGCTTCCCGGGAGCAATGTCTCACGGTTGGTTGAAAACTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGCTAAAGCTCGAGACCGGTCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTTTGACCCATGGGGGTCTGTTGGCCTCCTAATACGGGAACCTCAGG
       ((.((...((((((((((((((.(((.....))))))))))....)))))))....))))...(((.(((......))).)))..(((((((....(((((.(((((((.(((.((((((..((.((((...(((((....)))))..)))).)).)))).))..)))))))).)).....))))))))))))..(((((.(((((.((...))....)))))..)))))..
Query: GCACATCGTTGCCCCCGTGCCTTGGCCACGTGCTAGGCACCAAGCGGGGCGAATGTTGGCTTCCCGCGAGCAATGTCTCACGGTTGGTTGAAAATCGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTTAAAGCTCGAGACCGATCGTGCGAGTCACCCCCACCAGCTTTGCGACTCTTTGACCCATGGGGGTCTGTTGGCCTCCTAATACGGGAACCTCAGG
       ((.((...(((((((.((((((.(((.....))))))))).....)))))))....))))...(((.(((......))).)))..(((((((....(((((.(((((((.(((.((((((..((.((((...(((((....)))))..)))).)).)))).))..)))))))).)).....))))))))))))..(((((.(((((.((...))....)))))..)))))..
 CBCs: ________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
HCBCs: _______________________(_________)______________________________________________________________________________________________________(____)__________________________________________________________________________________________
Transferred percentage of helices I: 95.238
II: 100
III: 100
IV: 100
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Viridiplantae see NCBI Taxonomy
Streptophyta see NCBI Taxonomy
Streptophytina see NCBI Taxonomy
Embryophyta see NCBI Taxonomy
Tracheophyta see NCBI Taxonomy
Euphyllophyta see NCBI Taxonomy
Spermatophyta see NCBI Taxonomy
Magnoliophyta see NCBI Taxonomy
eudicotyledons see NCBI Taxonomy
core eudicotyledons see NCBI Taxonomy
rosids see NCBI Taxonomy
fabids see NCBI Taxonomy
Fabales see NCBI Taxonomy
Fabaceae see NCBI Taxonomy
Papilionoideae see NCBI Taxonomy
Crotalarieae see NCBI Taxonomy
Lebeckia see NCBI Taxonomy
Lebeckia sessilifolia see NCBI Taxonomy
169260560 (Method 3) see NCBI Nucleotide
Wiborgia see NCBI Taxonomy
Wiborgia sericea see NCBI Taxonomy
169260448 (Method 3) see NCBI Nucleotide
Genisteae see NCBI Taxonomy
Lupinus see NCBI Taxonomy
Lupinus albus see NCBI Taxonomy
108947920 (Method 3) see NCBI Nucleotide
Lupinus arboreus see NCBI Taxonomy
108947923 (Method 3) see NCBI Nucleotide
108947924 (Method 3) see NCBI Nucleotide
108947925 (Method 3) see NCBI Nucleotide
Lupinus luteus see NCBI Taxonomy
108947978 (Method 3) see NCBI Nucleotide
Lupinus polyphyllus see NCBI Taxonomy
61677022 (Method 3) see NCBI Nucleotide
61677023 (Method 3) see NCBI Nucleotide
61677024 (Method 3) see NCBI Nucleotide
61677025 (Method 3) see NCBI Nucleotide
61677026 (Method 3) see NCBI Nucleotide
61677027 (Method 3) see NCBI Nucleotide
61677028 (Method 3) see NCBI Nucleotide
61677029 (Method 3) see NCBI Nucleotide
61677030 (Method 3) see NCBI Nucleotide
61677031 (Method 3) see NCBI Nucleotide
61677032 (Method 3) see NCBI Nucleotide
61677033 (Method 3) see NCBI Nucleotide
61677034 (Method 3) see NCBI Nucleotide
61677035 (Method 3) see NCBI Nucleotide
61677036 (Method 3) see NCBI Nucleotide
61677037 (Method 3) see NCBI Nucleotide
61677038 (Method 3) see NCBI Nucleotide
61677039 (Method 3) see NCBI Nucleotide
61677040 (Method 3) see NCBI Nucleotide
61677041 (Method 3) see NCBI Nucleotide
61677042 (Method 3) see NCBI Nucleotide
61677043 (Method 3) see NCBI Nucleotide
61677044 (Method 3) see NCBI Nucleotide
61677045 (Method 3) see NCBI Nucleotide
61677046 (Method 3) see NCBI Nucleotide
61677047 (Method 3) see NCBI Nucleotide
61677048 (Method 3) see NCBI Nucleotide
61677049 (Method 3) see NCBI Nucleotide
Lupinus polyphyllus var. humicola see NCBI Taxonomy
Lupinus albescens see NCBI Taxonomy
108947919 (Method 3) see NCBI Nucleotide
Lupinus argenteus see NCBI Taxonomy
108947926 (Method 3) see NCBI Nucleotide
Lupinus cosentinii see NCBI Taxonomy
108947951 (Method 3) see NCBI Nucleotide
Lupinus hispanicus see NCBI Taxonomy
108947965 (Method 3) see NCBI Nucleotide
Lupinus latifolius see NCBI Taxonomy
108947972 (Method 3) see NCBI Nucleotide
Lupinus microcarpus see NCBI Taxonomy
108947957 (Method 3) see NCBI Nucleotide
108947969 (Method 3) see NCBI Nucleotide
108947982 (Method 3) see NCBI Nucleotide
Lupinus microcarpus var. densiflorus see NCBI Taxonomy
Lupinus mutabilis see NCBI Taxonomy
108947990 (Method 3) see NCBI Nucleotide
108947991 (Method 3) see NCBI Nucleotide
108947993 (Method 3) see NCBI Nucleotide
108947994 (Method 3) see NCBI Nucleotide
108947995 (Method 3) see NCBI Nucleotide
108947996 (Method 3) see NCBI Nucleotide
108947999 (Method 3) see NCBI Nucleotide
Lupinus pubescens see NCBI Taxonomy
108948016 (Method 3) see NCBI Nucleotide
Lupinus arizonicus see NCBI Taxonomy
108947927 (Method 3) see NCBI Nucleotide
Lupinus bracteolaris see NCBI Taxonomy
108947939 (Method 3) see NCBI Nucleotide
108947940 (Method 3) see NCBI Nucleotide
Lupinus crotalarioides see NCBI Taxonomy
108947952 (Method 3) see NCBI Nucleotide
108947953 (Method 3) see NCBI Nucleotide
108947954 (Method 3) see NCBI Nucleotide
Lupinus lepidus see NCBI Taxonomy
108947973 (Method 3) see NCBI Nucleotide
108947974 (Method 3) see NCBI Nucleotide
108947975 (Method 3) see NCBI Nucleotide
Lupinus multiflorus see NCBI Taxonomy
108947989 (Method 3) see NCBI Nucleotide
Lupinus villosus see NCBI Taxonomy
108948051 (Method 3) see NCBI Nucleotide
Lupinus bandelierae see NCBI Taxonomy
108947931 (Method 3) see NCBI Nucleotide
108947932 (Method 3) see NCBI Nucleotide
108947933 (Method 3) see NCBI Nucleotide
108947934 (Method 3) see NCBI Nucleotide
108947935 (Method 3) see NCBI Nucleotide
Lupinus brevicaulis see NCBI Taxonomy
108947942 (Method 3) see NCBI Nucleotide
Lupinus chamissonis see NCBI Taxonomy
108947946 (Method 3) see NCBI Nucleotide
108947947 (Method 3) see NCBI Nucleotide
108947948 (Method 3) see NCBI Nucleotide
Lupinus cumulicola see NCBI Taxonomy
108947955 (Method 3) see NCBI Nucleotide
108947956 (Method 3) see NCBI Nucleotide
Lupinus odoratus see NCBI Taxonomy
108948005 (Method 3) see NCBI Nucleotide
Lupinus sp. 4-CEH see NCBI Taxonomy
108947918 (Method 3) see NCBI Nucleotide
108948028 (Method 3) see NCBI Nucleotide
Lupinus sp. 5-CEH see NCBI Taxonomy
108948034 (Method 3) see NCBI Nucleotide
Lupinus hybrid cultivar see NCBI Taxonomy
108947914 (Method 3) see NCBI Nucleotide
Lupinus arvensis see NCBI Taxonomy
108947928 (Method 3) see NCBI Nucleotide
Lupinus ballianus see NCBI Taxonomy
108947930 (Method 3) see NCBI Nucleotide
Lupinus bangii see NCBI Taxonomy
108947937 (Method 3) see NCBI Nucleotide
108947985 (Method 3) see NCBI Nucleotide
108948029 (Method 3) see NCBI Nucleotide
Lupinus chachas see NCBI Taxonomy
108947945 (Method 3) see NCBI Nucleotide
Lupinus chrysanthus see NCBI Taxonomy
108947949 (Method 3) see NCBI Nucleotide
108947950 (Method 3) see NCBI Nucleotide
Lupinus ellsworthianus see NCBI Taxonomy
108947944 (Method 3) see NCBI Nucleotide
Lupinus gibertianus see NCBI Taxonomy
108947958 (Method 3) see NCBI Nucleotide
Lupinus guaraniticus see NCBI Taxonomy
108947959 (Method 3) see NCBI Nucleotide
108947960 (Method 3) see NCBI Nucleotide
Lupinus huaronensis see NCBI Taxonomy
108947966 (Method 3) see NCBI Nucleotide
Lupinus huigrensis see NCBI Taxonomy
108948033 (Method 3) see NCBI Nucleotide
Lupinus lanatus see NCBI Taxonomy
108947970 (Method 3) see NCBI Nucleotide
108947971 (Method 3) see NCBI Nucleotide
Lupinus lindleyanus see NCBI Taxonomy
108947976 (Method 3) see NCBI Nucleotide
Lupinus linearis see NCBI Taxonomy
108947968 (Method 3) see NCBI Nucleotide
108947977 (Method 3) see NCBI Nucleotide
Lupinus magnistipulatus see NCBI Taxonomy
108947979 (Method 3) see NCBI Nucleotide
108947980 (Method 3) see NCBI Nucleotide
Lupinus mantaroensis see NCBI Taxonomy
108947929 (Method 3) see NCBI Nucleotide
Lupinus microphyllus see NCBI Taxonomy
108947983 (Method 3) see NCBI Nucleotide
108947984 (Method 3) see NCBI Nucleotide
Lupinus misticola see NCBI Taxonomy
108947986 (Method 3) see NCBI Nucleotide
Lupinus mollendoensis see NCBI Taxonomy
108947987 (Method 3) see NCBI Nucleotide
Lupinus neomexicanus see NCBI Taxonomy
108948003 (Method 3) see NCBI Nucleotide
Lupinus nubigenus see NCBI Taxonomy
108948004 (Method 3) see NCBI Nucleotide
Lupinus paranensis see NCBI Taxonomy
108948008 (Method 3) see NCBI Nucleotide
Lupinus parvifolius see NCBI Taxonomy
108948009 (Method 3) see NCBI Nucleotide
Lupinus piurensis see NCBI Taxonomy
108948011 (Method 3) see NCBI Nucleotide
108948012 (Method 3) see NCBI Nucleotide
108948013 (Method 3) see NCBI Nucleotide
Lupinus praestabilis see NCBI Taxonomy
108948014 (Method 3) see NCBI Nucleotide
Lupinus prostratus see NCBI Taxonomy
108948015 (Method 3) see NCBI Nucleotide
Lupinus pulvinaris see NCBI Taxonomy
108948017 (Method 3) see NCBI Nucleotide
Lupinus purosericeus see NCBI Taxonomy
108947967 (Method 3) see NCBI Nucleotide
Lupinus ramosissimus see NCBI Taxonomy
108948018 (Method 3) see NCBI Nucleotide
Lupinus reitzii see NCBI Taxonomy
108948019 (Method 3) see NCBI Nucleotide
Lupinus rubriflorus see NCBI Taxonomy
108948021 (Method 3) see NCBI Nucleotide
Lupinus sarmentosus see NCBI Taxonomy
108948020 (Method 3) see NCBI Nucleotide
Lupinus semperflorens see NCBI Taxonomy
108947917 (Method 3) see NCBI Nucleotide
108948022 (Method 3) see NCBI Nucleotide
108948024 (Method 3) see NCBI Nucleotide
108948025 (Method 3) see NCBI Nucleotide
108948026 (Method 3) see NCBI Nucleotide
Lupinus sierrae-blancae see NCBI Taxonomy
108948027 (Method 3) see NCBI Nucleotide
Lupinus solanagrorum see NCBI Taxonomy
108948023 (Method 3) see NCBI Nucleotide
Lupinus subacaulis see NCBI Taxonomy
108948041 (Method 3) see NCBI Nucleotide
Lupinus subsessilis see NCBI Taxonomy
108948042 (Method 3) see NCBI Nucleotide
Lupinus tarapacensis see NCBI Taxonomy
108948043 (Method 3) see NCBI Nucleotide
Lupinus tomentosus see NCBI Taxonomy
108948046 (Method 3) see NCBI Nucleotide
Lupinus tominensis see NCBI Taxonomy
108947936 (Method 3) see NCBI Nucleotide
Lupinus uleanus see NCBI Taxonomy
108948048 (Method 3) see NCBI Nucleotide
Lupinus velutinus see NCBI Taxonomy
108948049 (Method 3) see NCBI Nucleotide
108948050 (Method 3) see NCBI Nucleotide
Lupinus weberbaueri see NCBI Taxonomy
108948053 (Method 3) see NCBI Nucleotide
Lupinus sp. 6-CEH see NCBI Taxonomy
108948035 (Method 3) see NCBI Nucleotide
Lupinus sp. 7-CEH see NCBI Taxonomy
108948031 (Method 3) see NCBI Nucleotide
Lupinus sp. 8-CEH see NCBI Taxonomy
108948032 (Method 3) see NCBI Nucleotide
Lupinus sp. CEH 2016 see NCBI Taxonomy
108948036 (Method 3) see NCBI Nucleotide
Lupinus sp. RJE 59 see NCBI Taxonomy
108948030 (Method 3) see NCBI Nucleotide
Lupinus sp. RJE 60 see NCBI Taxonomy
108947915 (Method 3) see NCBI Nucleotide
Genista see NCBI Taxonomy
Genista anglica see NCBI Taxonomy
108947910 (Method 3) see NCBI Nucleotide
Echinospartum see NCBI Taxonomy
Echinospartum barnadesii see NCBI Taxonomy
226525001 (Method 3) see NCBI Nucleotide
Stauracanthus see NCBI Taxonomy
Stauracanthus genistoides see NCBI Taxonomy
108948057 (Method 3) see NCBI Nucleotide
Sophoreae see NCBI Taxonomy
Sophora see NCBI Taxonomy
Sophora flavescens see NCBI Taxonomy
300068267 (Method 3) see NCBI Nucleotide
300089248 (Method 3) see NCBI Nucleotide
Thermopsideae see NCBI Taxonomy
Piptanthus see NCBI Taxonomy
Piptanthus nepalensis see NCBI Taxonomy
7739609 (Method 3) see NCBI Nucleotide
Annotation Process: Mixed HMM and Genbank annotation
Start: 396
End: 627

If you use the database please cite.