Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 5070527

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 5070527 see NCBI Nucleotide
Accession AF145564
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Agaricomycetes Agaricomycetes incertae sedis Corticiales Corticiaceae Hyphodontia Hyphodontia radula 
Sequence GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
Structure .........(((((((((((((......)))))).)))..))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
Method 2: Homology modeled
Energy -54.6 kcal/mol
Model 183987112
Alignment
Sbjct: GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGC-TTGGATTTGGGGATTGCTGGTTTTCAATCGGCTTCCCTTGAATGCATTAGCTGGAATTTAATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTAGCTTCTAATCGTCCTTCACGGGACAATTTGATCAATT-------------------
       .........(((((((((((((......)))))).))).-)))).((.(((((..(((((((...))))))).))))).)).......(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).))......-------------------
Query: GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTTGGACTTGGGGATTGCTGGTGCA-AATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
       .........(((((((((((((......)))))).)))..))))..(.(((((..((((((...-.)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
 CBCs: ____________________________________________________________________________________________________________________________________________________________________________________________________________________
HCBCs: __________________________________________________________(_________)______________________(_______(__________________________________________________)____)________________________________________________________
Transferred percentage of helices I: 100
II: 85.714
III: 100
IV: 100
Annotation Process: Mixed HMM and Genbank annotation
Start: 354
End: 564

If you use the database please cite.