Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 162136045

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 162136045 see NCBI Nucleotide
Accession EU273513
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Agaricomycetes Agaricomycetes incertae sedis Polyporales Ganodermataceae Ganoderma Ganoderma gibbosum 
Sequence ATGAAATCTTCAATCTACAAACTTCTTATGGGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGTCCCTTTACAGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTTGTCGGTGTGATAATGTCTACGCCGCGACCGTGAAGCGTGTTTGGGCGAGCTTCTAACCGTCTCGTTACAGAGACAACTTTTATGACCTCTGA
Structure ....((..(((((((((((((((((....)))))))))))).))))).))(((((...(((((..(((....)))))))).)))))..........((((((..(((((((...((((.(((.(((((((((...))).)))))))))))).)..))).)...))))))))).......(((((.(...))))))..................
Method 2: Homology modeled
Energy -48.9 kcal/mol
Model 55820070
Alignment
Sbjct: ATGAAATMTTCAATCTACAAACTTCTTATGGGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGTCCCTTTACAGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTTGTCGGTGTGATAATGTCTACGCCGCGACCGTGAAGCGTGTTTGGGCGAGCTTCTAACCGTCTCGTTACAGAGACAACTTTTATGACCTCTGA
       ....((..(((((((((((((((((....)))))))))))).))))).))(((((...(((((..(((....)))))))).)))))..........((((((..(((.(((....(((.(((.(((((((((...))).))))))))))))....))).....))))))))).......(((((......)))))..................
Query: ATGAAATCTTCAATCTACAAACTTCTTATGGGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGTCCCTTTACAGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTTGTCGGTGTGATAATGTCTACGCCGCGACCGTGAAGCGTGTTTGGGCGAGCTTCTAACCGTCTCGTTACAGAGACAACTTTTATGACCTCTGA
       ....((..(((((((((((((((((....)))))))))))).))))).))(((((...(((((..(((....)))))))).)))))..........((((((..(((.(((....(((.(((.(((((((((...))).))))))))))))....))).....))))))))).......(((((......)))))..................
 CBCs: _____________________________________________________________________________________________________________________________________________________________________________________________________________________
HCBCs: _____________________________________________________________________________________________________________________________________________________________________________________________________________________
Transferred percentage of helices I: 100
II: 100
III: 100
IV: 100
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetes incertae sedis see NCBI Taxonomy
Polyporales see NCBI Taxonomy
Ganodermataceae see NCBI Taxonomy
Ganoderma see NCBI Taxonomy
Ganoderma lucidum see NCBI Taxonomy
90109958 (Method 3) see NCBI Nucleotide
90109959 (Method 3) see NCBI Nucleotide
90109960 (Method 3) see NCBI Nucleotide
90109962 (Method 3) see NCBI Nucleotide
90109963 (Method 3) see NCBI Nucleotide
90109968 (Method 3) see NCBI Nucleotide
90109969 (Method 3) see NCBI Nucleotide
90109970 (Method 3) see NCBI Nucleotide
90109972 (Method 3) see NCBI Nucleotide
90109973 (Method 3) see NCBI Nucleotide
90109974 (Method 3) see NCBI Nucleotide
90109975 (Method 3) see NCBI Nucleotide
90109976 (Method 3) see NCBI Nucleotide
90109977 (Method 3) see NCBI Nucleotide
90109978 (Method 3) see NCBI Nucleotide
90109980 (Method 3) see NCBI Nucleotide
90109981 (Method 3) see NCBI Nucleotide
90109982 (Method 3) see NCBI Nucleotide
90109983 (Method 3) see NCBI Nucleotide
90109986 (Method 3) see NCBI Nucleotide
90109996 (Method 3) see NCBI Nucleotide
90109997 (Method 3) see NCBI Nucleotide
90110001 (Method 3) see NCBI Nucleotide
90110002 (Method 3) see NCBI Nucleotide
90110004 (Method 3) see NCBI Nucleotide
Ganoderma applanatum see NCBI Taxonomy
194306773 (Method 3) see NCBI Nucleotide
Ganoderma australe see NCBI Taxonomy
63098761 (Method 3) see NCBI Nucleotide
Ganoderma tsugae see NCBI Taxonomy
90109990 (Method 3) see NCBI Nucleotide
90109993 (Method 3) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 412
End: 624

If you use the database please cite.