Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 608487

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 608487 see NCBI Nucleotide
Accession U15973
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Agaricomycetes Agaricomycetidae Agaricales Pluteaceae Volvariella Volvariella volvacea 
Sequence ATCGAATCCTCAAGCCCAGCCCGGCTTCTCCCCGGGCTTTTGGGGGCTTGGAGTTGGGAGCTGTGCGGGTCGCTAGCCTTCGCGATCCGCTCTCCTCAAAGGCATCAGCAGGGCCCAGTCGCAGTCGGCCTCGTGGCGTTGATAGTCCATCTACGCCCCCCCGCGGCCGCACTCAGCGTGGCTCGGCTTCGAACCGTCCGGACACACCCCGGCCTCACCCCTTGACACCCTTGA
Structure ......(((..((((((....((((((......))).))..)))).))))))..((((.(..(.(((((((((..(...).)))))))))).).)))).........((..((....((.((.(((((....(.((((.((((.....))).))))))..))..))).)))))).))...(.((((..(.(....((....)).))..)))).)....................
Method 2: Homology modeled
Energy -20.3 kcal/mol
Model 37954646
Alignment
Sbjct: ATTAAATCCTCAATCAC------GCCACTTGTTTGGTT----GTGACTTGGATGTTGGGGGTATGCAGGCCTCTGTATTTTGAGGTCAGCTCTCCTGAAATGCATTAGC-GGAACCGTTTGCGGTCAGTCGC-CGGTG-TGATAAT-TATCTACGCCCAAGACCACGGCTGCTCTCTGTGT-GTTCAGCTTCCAATCGTCCATTTGTGGACAACTTCTGAATATTT----------------
       .....((((....((((------((((......))).)----))))...)))).(((((((...((.((((((........)))))).)).))))))).........((-(((.......((((((.(((..-.((((-((((...-.))).)))))...)))...))))))..)))))..-((((((.........(((((....))))).....))))))....----------------
Query: ATCGAATCCTCAAGCCCAGCCCGGCTTCTCCCCGGGCTTTTGGGGGCTTGGAGTTGGGAGCTGTGCGGGTCGCTAGCCTTCGCGATCCGCTCTCCTCAAAGGCATCAGCAGGGCCCAGTCGCAGTCGGCCTCGTGGCGTTGATAGTCCATCTACGCCCC--CCCGCGGCCGCACTCAGCGTGGCTCGGCTTCGAACCGTCC------GGACACACCCCGGCCTCACCCCTTGACACCCTTGA
       ......(((.....(((......((((......))).)....)))....)))..((((.(....((.((((((........)))))).))..).)))).........((..((.......((.(((.(......((((.((((.....))).)))))..--.)...))).))..)).))...(.((((.........((((------)))).....)))).)....................
 CBCs: _______________(__________(______)_________)___________(_____________(_(__________)_)___________)_________________________________________________________________________________________(______________________________)________________________
HCBCs: _________________________(________)________________________________________________________________________(____(_______________________(_________________)___________________)___)___(_(__________________________________)_)____________________
Transferred percentage of helices I: 83.333
II: 86.667
III: 81.818
IV: 81.818
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetidae see NCBI Taxonomy
Agaricales see NCBI Taxonomy
Pluteaceae see NCBI Taxonomy
Volvariella see NCBI Taxonomy
Volvariella volvacea see NCBI Taxonomy
49357474 (Method 3) see NCBI Nucleotide
49357494 (Method 3) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 441
End: 674

If you use the database please cite.