Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 156567646

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 156567646 see NCBI Nucleotide
Accession EU084978
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Agaricomycetes Agaricomycetidae Agaricales Hymenogastraceae Hymenogaster Hymenogaster sublilacinus 
Sequence ATTAATATATATCAACCTCTTCAGCTTTTGTTTGTCGAGTGTTGGATGTGGGGGGTCTTTTTTTTGCTGGTCTTCTTACAAAGTCAGCTCCCCTTAAATGTATTAGCAGAACAATTTGTGGATCTGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAACA
Structure ...........((((((((..(((.(...).)))..))).))))).(((((((((((....(...)..)))).))))))).....((.(((...(((((((....)))......)))).))).))..(((.(((((((((....))).)))))).))).........
Method 2: Homology modeled
Energy -17 kcal/mol
Model 156567649
Alignment
Sbjct: ATTAATATATATCAACCTCTTCAGCTTTTGTTTGTCGAGTGTTGGGTGTGGGGGGCC---TTTGTGCTGGTC-TCTTACAATGTAGACTCCCCTTAAATGCATTGGCAGAACAATTTGTGGACTCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAACAC
       ...........((((((((..(((.......)))..))).))))).(((((((((((---........))))-))))))).....((.(((...(((((((....)))......)))).))).))..(((.(((((((((....))).)))))).)))..........
Query: ATTAATATATATCAACCTCTTCAGCTTTTGTTTGTCGAGTGTTGGATGTGGGGGGTCTTTTTTTTGCTGGTCTTCTTACAAAGTCAGCTCCCCTTAAATGTATTAGCAGAACAATTTGTGGATCTGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAACA-
       ...........((((((((..(((.......)))..))).))))).(((((((((((...........)))).))))))).....((.(((...(((((((....)))......)))).))).))..(((.(((((((((....))).)))))).))).........-
 CBCs: _____________________________________________________________________________________((____________________________________))___________________________________________
HCBCs: _______________________________________________________(_____________)______________________________(____)______________________________________________________________
Transferred percentage of helices I: 100
II: 100
III: 100
IV: 100
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetidae see NCBI Taxonomy
Agaricales see NCBI Taxonomy
Tricholomataceae see NCBI Taxonomy
Panellus see NCBI Taxonomy
Panellus edulis see NCBI Taxonomy
254972176 (Method 3) see NCBI Nucleotide
Sarcomyxa see NCBI Taxonomy
Sarcomyxa serotina see NCBI Taxonomy
262035039 (Method 3) see NCBI Nucleotide
Cortinariaceae see NCBI Taxonomy
Cortinarius see NCBI Taxonomy
Cortinarius basirubescens see NCBI Taxonomy
293337671 (Method 3) see NCBI Nucleotide
Cortinarius erythrocephalus see NCBI Taxonomy
293337675 (Method 3) see NCBI Nucleotide
Cortinarius persplendidus see NCBI Taxonomy
293337679 (Method 3) see NCBI Nucleotide
Lyophyllaceae see NCBI Taxonomy
Lyophyllum see NCBI Taxonomy
Lyophyllum anthracophilum see NCBI Taxonomy
15088849 (Method 3) see NCBI Nucleotide
Tephrocybe see NCBI Taxonomy
Tephrocybe rancida see NCBI Taxonomy
189170059 (Method 3) see NCBI Nucleotide
193297304 (Method 3) see NCBI Nucleotide
Annotation Process: Mixed HMM and Genbank annotation
Start: 376
End: 542

If you use the database please cite.