Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 189306935

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 189306935 see NCBI Nucleotide
Accession EU597024
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Agaricomycetes Agaricomycetes incertae sedis Cantharellales Clavulinaceae environmental samples uncultured Clavulina 
Sequence GCGAAATTTCTCAAGCTTGGATGGNATTTTTGTCCGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGCACGGNTGGNCTTAAAAGCATTANCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGANGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGCTTCACAGATTGTACAATTTGNGTTCCACATNTCAGCTTTGA
Structure (((((..((((((((.((((((((.(.(...)))))).).))).))))).....))).))))).(((((...(((.((.((((((((..((...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))..............
Method 2: Homology modeled
Energy -16.6 kcal/mol
Model 215433632
Alignment
Sbjct: GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGTTTCACAGATTGTRCAATCTGTGTTCCACAT-TCAGC-TTGACCTCGA
       (((((..((((((((.(((((((((..(...))))))..).))).))))).....))).))))).(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))...-.....-..........
Query: GCGAAATTTCTCAAGCTTGGATGGNATTTTTGTCCGT-CCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGCACGGNTGGNCTTAAAAGCATTANCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGANGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGCTTCACAGATTGTACAATTTGNGTTCCACATNTCAGCTTTGA------
       (((((..((((((((.((((((((...(...).))))-.).))).))))).....))).))))).(((((...(((.((.((((.(((...(...).)..)).))).)))..))).))))).(((...((((((.((((....((.(((.(((((.(.((....)).).)).))).))))).)))))))))).)))........(((...(.((((.(.....))))).)..)))..............------
 CBCs: _______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
HCBCs: ______________________________________________________________________________________(_____________)_________________________________________________________________________________________________________________(__________)_____________________________
Transferred percentage of helices I: 95.652
II: 90
III: 96.296
IV: 90
Annotation Process: HMM annotation
Start: 285
End: 532

If you use the database please cite.