Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 145207490

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 145207490 see NCBI Nucleotide
Accession AJ937997
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi environmental samples uncultured ectomycorrhizal fungus 
Sequence ACGAAATTTCTCAAGCCTGGATGGCCTTTGTCTATCCTTAGCTTGGTTGTTGGGCTTTGCCGTGCCCTTCATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGTACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCTAAACCCTGGTTTTACAGATTCTTCAATCTGTGTCCACTTTCAGACTT
Structure .((((..((((((((.((((((((.(...).)))).).)))))))).....))).))))..(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).))).........(((...((((((.(.....))))))).)))...........
Method 2: Homology modeled
Energy -29.6 kcal/mol
Model 215433632
Alignment
Sbjct: GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAA-CTTGGTTTCACAGATTGTRCAATCTGTGTTCCACATTCAGCTTGACCTCGA
       (((((..((((((((.(((((((((..(...))))))..).))).))))).....))).))))).(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))......-..(((...((((((.(.....)))))))..)))..................
Query: ACGAAATTTCTCAAGCCTGGATGG--CCTTTGTCTAT-CCTTAG-CTTGGTTGTTGGGCTTTGCCGTGCCCTTCATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGTACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCTAAACCCTGGTTTTACAGATTCTTCAATCTGTG-TCCACTTTCAGACTT-------
       .((((..((((((((.((((((((--.(...).))))-.).)))-))))).....))).))))..(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).))).........(((...((((((.(.....)))))))-.)))...........-------
 CBCs: ______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
HCBCs: ________________(____((____(___)__))_______)_______________________((_________________(_____________)________________))_________________________(__________________________________)_______________________________(__________________)_______________________
Transferred percentage of helices I: 91.304
II: 100
III: 100
IV: 100
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured ectomycorrhizal fungus see NCBI Taxonomy
262113662 (Method 2) see NCBI Nucleotide
Annotation Process: Mixed HMM and Genbank annotation
Start: 348
End: 589

If you use the database please cite.