Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 62484160

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 62484160 see NCBI Nucleotide
Accession AY874153
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Pucciniomycotina Pucciniomycetes Pucciniales Pucciniaceae Puccinia Puccinia graminis 
Sequence ATGAAACCCTCTCATTAAACATTTTTTTTTTAATAATTTGTTTATTGGATGTTGAGTGTTGCTATAATTATAGCTCACTTTAAATATATAAGTCACTTTTCAAATAAGTTGGATTGACTTGGTGTAATAATTTTATCATCACATCAAGGAAAGTAGTAAAACACTTGCCATCTTTTTTGTAACAAGAGACTCCTAAAAACCCAATATCTATTTTTTTAAGA
Structure .....(.(.((.((.((((((......((.....))..)))))).)))).).)(((((..(((((....))))).))))).......(..((((..((((((((.(((.(((.......((((((.((.(((((..(.(.......).)))))).))...))))).)))).))).)))).)..))).))))..)............(((.(......))))
Method 2: Homology modeled
Energy -2.21 kcal/mol
Model 94450569
Alignment
Sbjct: ATGAAACCCTCTCATTAAACA-TTTTTTTTTAATAATTTGTTTATTGGATGTTGAGTGTTGCTATAATTATAGCTCACTTTAAATATATAAGTCACTTTTCAAATAAGTTGGATTGACTTGGTGTAATAATTTTATCATCACATCAAGGAAAGTAGTAAAACACTTGCCATCTTTTTTGTAACAAGAGACTCCTAAAAACCCAATATCTATTTTTTTAAGA
       .....(.(.((.((.((((((-.....((.....))..)))))).)))).).)(((((..(((((....))))).))))).......(..((((..((((((((.(((.(((.......((((((.((.(((((..(.(.......).)))))).))...))))).)))).))).)))).)..))).))))..)............(((.(......))))
Query: ATGAAACCCTCTCATTAAACATTTTTTTTTTAATAATTTGTTTATTGGATGTTGAGTGTTGCTATAATTATAGCTCACTTTAAATATATAAGTCACTTTTCAAATAAGTTGGATTGACTTGGTGTAATAATTTTATCATCACATCAAGGAAAGTAGTAAAACACTTGCCATCTTTTTTGTAACAAGAGACTCCTAAAAACCCAATATCTATTTTTTTAAGA
       .....(.(.((.((.((((((......((.....))..)))))).)))).).)(((((..(((((....))))).))))).......(..((((..((((((((.(((.(((.......((((((.((.(((((..(.(.......).)))))).))...))))).)))).))).)))).)..))).))))..)............(((.(......))))
 CBCs: _____________________________________________________________________________________________________________________________________________________________________________________________________________________________
HCBCs: _____________________________________________________________________________________________________________________________________________________________________________________________________________________________
Transferred percentage of helices I: 100
II: 100
III: 100
IV: 100
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Pucciniomycotina see NCBI Taxonomy
Pucciniomycetes see NCBI Taxonomy
Pucciniales see NCBI Taxonomy
Pucciniaceae see NCBI Taxonomy
Puccinia see NCBI Taxonomy
Puccinia graminis see NCBI Taxonomy
169600 (Method 3) see NCBI Nucleotide
Puccinia graminis f. sp. secalis see NCBI Taxonomy
Annotation Process: HMM annotation
Start: 426
End: 646

If you use the database please cite.