Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 194304320

Figure

(Save as SVG or PNG)

Details

GI 194304320 see NCBI Nucleotide
Accession EU819482
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Agaricomycetes Agaricomycetes incertae sedis Russulales Russulaceae Lactarius Lactarius cf. subserifluus JMP0041 
Sequence TCAACCTCCTTGGTTTCTTTCTGGAGACTGAAGGAGGCTTGGACTTTGGAGGCCTTTGCTGGTGTCTCTCACCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACACGTGATAAGATGCTTCCGTGTCTCGGTTTCTGGCTCTGTTGCTTTTGGGACCCGCTTCTAACCGTCTGGACCCTTGTGTCGAGAC
Structure (((((((.(((((((((.(...))))))).)).)))).))))..((((((((.....(((((((....).)))))).)))).))))......((((((.((((..(((((((.((..((((((.(.((...)).)..))))))..))..)).)))...)..).....)))))))))).......((((.((.(.....))).))))
Method 3: Partial structure
Energy -38.3 kcal/mol
Model 61657184
Alignment
Sbjct: ----NTGAAAACCTCAACCTCCTTGGTTTCTTTCTGGAGACTGAACGAGGCTTTGGACTTTGGAGGCCTTTTGCTGCGTGTCTCTCACCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACACGTGATAAGATGCTTCCGTGTCTCGGTTTCTGGCTCTGTTGCTTTTGGGACCCGCTTCTAACCGTCTGGA-CCTTGCGTCGAGACAATGTTCGAGATCGTCTCCCTTCTCGGGAAACCCCCTCGACCCCACGAACCCTTGG
       ----.........(((((((.(((((((((.(...))))))).)).))))..))))..((((((((......((((.(((....).)))))).)))).))))......((((((.((((..(((((((.((..((((((.(.((...)).)..))))))..))..)).)))...)..).....)))))))))).......((((.((-(.....))).))))........................................................
Query: TGTCGCGAAAACCTCAACCTCCTTGGTTTCTTTCTGGAGACTGAAGGAGGC-TTGGACTTTGGAGGCC-TTTGCTG-GTGTCTCTCACCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACACGTGATAAGATGCTTCCGTGTCTCGGTTTCTGGCTCTGTTGCTTTTGGGACCCGCTTCTAACCGTCTGGACCCTTGTGTCGAGACAATGTTCGAGAT--------------------------------------------
       .............(((((((.(((((((((.(...))))))).)).)))).-))))..((((((((..-...((((-(((....).)))))).)))).))))......((((((.((((..(((((((.((..((((((.(.((...)).)..))))))..))..)).)))...)..).....)))))))))).......((((.((.(.....))).))))............--------------------------------------------
 CBCs: ______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
HCBCs: ______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
Transferred percentage of helices I: 100
II: 100
III: 100
IV: 100
Annotation Process: Blast (re)annotation
Start: 433
End: 664

If you use the database please cite.