Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 117557332

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 117557332 see NCBI Nucleotide
Accession EF025974
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Ascomycota saccharomyceta Pezizomycotina leotiomyceta sordariomyceta Sordariomycetes Hypocreomycetidae Hypocreomycetidae incertae sedis Glomerellaceae mitosporic Glomerellaceae Colletotrichum Colletotrichum capsici 
Sequence ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
Structure ....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
Method 1: RNAfold - direct fold
Energy -51.4 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured fungus see NCBI Taxonomy
188530071 (Method 2) see NCBI Nucleotide
unclassified Fungi see NCBI Taxonomy
fungal endophyte sp. AP269 see NCBI Taxonomy
317415277 (Method 2) see NCBI Nucleotide
fungal endophyte sp. g110 see NCBI Taxonomy
300872447 (Method 2) see NCBI Nucleotide
fungal endophyte sp. g3 see NCBI Taxonomy
300872405 (Method 2) see NCBI Nucleotide
fungal endophyte sp. g40 see NCBI Taxonomy
300872408 (Method 2) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Ascomycota see NCBI Taxonomy
saccharomyceta see NCBI Taxonomy
Pezizomycotina see NCBI Taxonomy
leotiomyceta see NCBI Taxonomy
sordariomyceta see NCBI Taxonomy
Leotiomycetes see NCBI Taxonomy
Erysiphales see NCBI Taxonomy
Erysiphaceae see NCBI Taxonomy
Pleochaeta see NCBI Taxonomy
Pleochaeta indica see NCBI Taxonomy
107599318 (Method 2) see NCBI Nucleotide
Sordariomycetes see NCBI Taxonomy
Hypocreomycetidae see NCBI Taxonomy
Hypocreomycetidae incertae sedis see NCBI Taxonomy
Glomerellaceae see NCBI Taxonomy
Glomerella see NCBI Taxonomy
Glomerella cingulata see NCBI Taxonomy
2573 (Method 2) see NCBI Nucleotide
15027035 (Method 2) see NCBI Nucleotide
17426681 (Method 2) see NCBI Nucleotide
24459968 (Method 2) see NCBI Nucleotide
27544349 (Method 2) see NCBI Nucleotide
27544351 (Method 2) see NCBI Nucleotide
27544352 (Method 2) see NCBI Nucleotide
28625443 (Method 2) see NCBI Nucleotide
28625492 (Method 2) see NCBI Nucleotide
28625493 (Method 2) see NCBI Nucleotide
28625506 (Method 2) see NCBI Nucleotide
33326794 (Method 2) see NCBI Nucleotide
33326805 (Method 2) see NCBI Nucleotide
55420636 (Method 2) see NCBI Nucleotide
55585699 (Method 2) see NCBI Nucleotide
55585700 (Method 2) see NCBI Nucleotide
55585703 (Method 2) see NCBI Nucleotide
55585704 (Method 2) see NCBI Nucleotide
55585705 (Method 2) see NCBI Nucleotide
55585706 (Method 2) see NCBI Nucleotide
55585707 (Method 2) see NCBI Nucleotide
62903137 (Method 2) see NCBI Nucleotide
62903141 (Method 2) see NCBI Nucleotide
74182850 (Method 2) see NCBI Nucleotide
82799438 (Method 2) see NCBI Nucleotide
92429592 (Method 2) see NCBI Nucleotide
92429595 (Method 2) see NCBI Nucleotide
92429596 (Method 2) see NCBI Nucleotide
92429598 (Method 2) see NCBI Nucleotide
92429599 (Method 2) see NCBI Nucleotide
92429600 (Method 2) see NCBI Nucleotide
92429601 (Method 2) see NCBI Nucleotide
92429602 (Method 2) see NCBI Nucleotide
92429603 (Method 2) see NCBI Nucleotide
92429604 (Method 2) see NCBI Nucleotide
92429605 (Method 2) see NCBI Nucleotide
92429606 (Method 2) see NCBI Nucleotide
92430200 (Method 2) see NCBI Nucleotide
114213452 (Method 2) see NCBI Nucleotide
117557290 (Method 2) see NCBI Nucleotide
117557291 (Method 2) see NCBI Nucleotide
117557295 (Method 2) see NCBI Nucleotide
117557297 (Method 2) see NCBI Nucleotide
148807682 (Method 2) see NCBI Nucleotide
148807684 (Method 2) see NCBI Nucleotide
168252996 (Method 2) see NCBI Nucleotide
190364836 (Method 2) see NCBI Nucleotide
225545555 (Method 2) see NCBI Nucleotide
239584275 (Method 2) see NCBI Nucleotide
256275032 (Method 2) see NCBI Nucleotide
281332314 (Method 2) see NCBI Nucleotide
281332330 (Method 2) see NCBI Nucleotide
281332335 (Method 2) see NCBI Nucleotide
283459403 (Method 2) see NCBI Nucleotide
298258848 (Method 2) see NCBI Nucleotide
299151536 (Method 2) see NCBI Nucleotide
304334042 (Method 2) see NCBI Nucleotide
304434488 (Method 2) see NCBI Nucleotide
307239144 (Method 2) see NCBI Nucleotide
Colletotrichum gloeosporioides see NCBI Taxonomy
Colletotrichum cf. gloeosporioides ROG-2010 see NCBI Taxonomy
307239144 (Method 2) see NCBI Nucleotide
Glomerella acutata see NCBI Taxonomy
17426630 (Method 2) see NCBI Nucleotide
17426653 (Method 2) see NCBI Nucleotide
17426682 (Method 2) see NCBI Nucleotide
17426683 (Method 2) see NCBI Nucleotide
38606385 (Method 2) see NCBI Nucleotide
66990184 (Method 2) see NCBI Nucleotide
96776016 (Method 2) see NCBI Nucleotide
96776024 (Method 2) see NCBI Nucleotide
117557326 (Method 2) see NCBI Nucleotide
121487786 (Method 2) see NCBI Nucleotide
134290412 (Method 2) see NCBI Nucleotide
134290413 (Method 2) see NCBI Nucleotide
134290415 (Method 2) see NCBI Nucleotide
156071380 (Method 2) see NCBI Nucleotide
157011475 (Method 2) see NCBI Nucleotide
282801666 (Method 2) see NCBI Nucleotide
282801675 (Method 2) see NCBI Nucleotide
285266573 (Method 2) see NCBI Nucleotide
285266576 (Method 2) see NCBI Nucleotide
mitosporic Glomerellaceae see NCBI Taxonomy
Colletotrichum see NCBI Taxonomy
Colletotrichum capsici see NCBI Taxonomy
148807680 (Method 2) see NCBI Nucleotide
298573175 (Method 2) see NCBI Nucleotide
298573181 (Method 2) see NCBI Nucleotide
299851124 (Method 2) see NCBI Nucleotide
Colletotrichum truncatum see NCBI Taxonomy
45331293 (Method 2) see NCBI Nucleotide
Colletotrichum fragariae see NCBI Taxonomy
6650330 (Method 2) see NCBI Nucleotide
Colletotrichum dematium see NCBI Taxonomy
166797299 (Method 2) see NCBI Nucleotide
Colletotrichum trichellum see NCBI Taxonomy
17426690 (Method 2) see NCBI Nucleotide
82799404 (Method 2) see NCBI Nucleotide
257195193 (Method 2) see NCBI Nucleotide
263043757 (Method 2) see NCBI Nucleotide
Colletotrichum carthami see NCBI Taxonomy
24459958 (Method 2) see NCBI Nucleotide
24459959 (Method 2) see NCBI Nucleotide
24459964 (Method 2) see NCBI Nucleotide
117557331 (Method 2) see NCBI Nucleotide
Colletotrichum circinans see NCBI Taxonomy
257195191 (Method 2) see NCBI Nucleotide
Colletotrichum sp. Pass-35 see NCBI Taxonomy
33326793 (Method 2) see NCBI Nucleotide
Colletotrichum sp. MEP1530 see NCBI Taxonomy
82799402 (Method 2) see NCBI Nucleotide
Colletotrichum sp. DRC-G1 see NCBI Taxonomy
154125143 (Method 2) see NCBI Nucleotide
Colletotrichum sp. Vega092 see NCBI Taxonomy
157697382 (Method 2) see NCBI Nucleotide
Colletotrichum sp. Vega437 see NCBI Taxonomy
157697389 (Method 2) see NCBI Nucleotide
Colletotrichum sp. Vega594 see NCBI Taxonomy
157697395 (Method 2) see NCBI Nucleotide
Colletotrichum sp. Vega725 see NCBI Taxonomy
157697384 (Method 2) see NCBI Nucleotide
Colletotrichum sp. Vega007 see NCBI Taxonomy
157986177 (Method 2) see NCBI Nucleotide
Colletotrichum sp. ICMP 17327 see NCBI Taxonomy
169135015 (Method 2) see NCBI Nucleotide
Colletotrichum sp. ICMP 17328 see NCBI Taxonomy
169135016 (Method 2) see NCBI Nucleotide
Colletotrichum sp. 8Mb1.3 see NCBI Taxonomy
169135079 (Method 2) see NCBI Nucleotide
Colletotrichum ricini see NCBI Taxonomy
189162055 (Method 2) see NCBI Nucleotide
Colletotrichum sp. 3 L13 see NCBI Taxonomy
208243644 (Method 2) see NCBI Nucleotide
Colletotrichum sp. EXMY-22 see NCBI Taxonomy
209360967 (Method 2) see NCBI Nucleotide
Colletotrichum sp. EXMY-39 see NCBI Taxonomy
209360971 (Method 2) see NCBI Nucleotide
Colletotrichum sp. PP117 see NCBI Taxonomy
229560259 (Method 2) see NCBI Nucleotide
Colletotrichum sp. HD060405 see NCBI Taxonomy
259013108 (Method 2) see NCBI Nucleotide
Colletotrichum siamense see NCBI Taxonomy
282801669 (Method 2) see NCBI Nucleotide
Colletotrichum asianum see NCBI Taxonomy
282801670 (Method 2) see NCBI Nucleotide
282801677 (Method 2) see NCBI Nucleotide
282801680 (Method 2) see NCBI Nucleotide
Colletotrichum simmondsii see NCBI Taxonomy
263043795 (Method 2) see NCBI Nucleotide
288188867 (Method 2) see NCBI Nucleotide
288188868 (Method 2) see NCBI Nucleotide
288188869 (Method 2) see NCBI Nucleotide
288188870 (Method 2) see NCBI Nucleotide
288188873 (Method 2) see NCBI Nucleotide
288188879 (Method 2) see NCBI Nucleotide
288188880 (Method 2) see NCBI Nucleotide
288188884 (Method 2) see NCBI Nucleotide
288188889 (Method 2) see NCBI Nucleotide
288188890 (Method 2) see NCBI Nucleotide
288188891 (Method 2) see NCBI Nucleotide
288188892 (Method 2) see NCBI Nucleotide
288188893 (Method 2) see NCBI Nucleotide
288188894 (Method 2) see NCBI Nucleotide
288188895 (Method 2) see NCBI Nucleotide
288188896 (Method 2) see NCBI Nucleotide
288188897 (Method 2) see NCBI Nucleotide
288188900 (Method 2) see NCBI Nucleotide
288188910 (Method 2) see NCBI Nucleotide
288188911 (Method 2) see NCBI Nucleotide
Colletotrichum sp. 109AC/S see NCBI Taxonomy
283856792 (Method 2) see NCBI Nucleotide
Colletotrichum sp. 154AC/S see NCBI Taxonomy
283856825 (Method 2) see NCBI Nucleotide
Colletotrichum sp. 52AC/S see NCBI Taxonomy
283856752 (Method 2) see NCBI Nucleotide
Colletotrichum sp. 71CA/L see NCBI Taxonomy
283856764 (Method 2) see NCBI Nucleotide
Colletotrichum horii see NCBI Taxonomy
288887085 (Method 2) see NCBI Nucleotide
288887086 (Method 2) see NCBI Nucleotide
288887087 (Method 2) see NCBI Nucleotide
288887088 (Method 2) see NCBI Nucleotide
Colletotrichum sp. MFU09 0621 see NCBI Taxonomy
298107926 (Method 2) see NCBI Nucleotide
Colletotrichum sp. MFU09 0622 see NCBI Taxonomy
298107925 (Method 2) see NCBI Nucleotide
Colletotrichum sp. MFU09 0623 see NCBI Taxonomy
298107923 (Method 2) see NCBI Nucleotide
Colletotrichum sp. MFU09 0625 see NCBI Taxonomy
298107924 (Method 2) see NCBI Nucleotide
Colletotrichum sp. MFU09 0640 see NCBI Taxonomy
298107943 (Method 2) see NCBI Nucleotide
Colletotrichum sp. MFU09 0624 see NCBI Taxonomy
298107947 (Method 2) see NCBI Nucleotide
Colletotrichum sp. RP5 see NCBI Taxonomy
299891504 (Method 2) see NCBI Nucleotide
Colletotrichum sp. WF115 see NCBI Taxonomy
307543272 (Method 2) see NCBI Nucleotide
Colletotrichum sp. WF134 see NCBI Taxonomy
307543289 (Method 2) see NCBI Nucleotide
Colletotrichum ignotum see NCBI Taxonomy
312264735 (Method 2) see NCBI Nucleotide
Colletotrichum sp. 1091 see NCBI Taxonomy
312264736 (Method 2) see NCBI Nucleotide
Colletotrichum sp. GJS08_143 see NCBI Taxonomy
312264731 (Method 2) see NCBI Nucleotide
Colletotrichum sp. GJS08_146 see NCBI Taxonomy
312264733 (Method 2) see NCBI Nucleotide
Colletotrichum sp. GJS08_147 see NCBI Taxonomy
312264732 (Method 2) see NCBI Nucleotide
Colletotrichum sp. GJS08_148 see NCBI Taxonomy
312264734 (Method 2) see NCBI Nucleotide
Sordariomycetidae see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured Sordariomycetidae see NCBI Taxonomy
82796482 (Method 2) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 314
End: 478

If you use the database please cite.