Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 118161445

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 118161445 see NCBI Nucleotide
Accession EF068064
Date 2011/04/01
Lineage see NCBI Taxonomy root cellular organisms Eukaryota Fungi/Metazoa group Fungi Dikarya Basidiomycota Agaricomycotina Tremellomycetes Tremellales Tremellaceae Filobasidiella Filobasidiella/Cryptococcus neoformans species complex Cryptococcus neoformans 
Sequence ATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTTGTTTGA
Structure ....(((((.((((((..(((((......)))))..))).))))))))(((((...((((((.(((....))).)).)))).))))).......(((((((((..((.((((((((....((((((((.((....)).)))))))).....)))))))).))..)))))))))..(((.((.........)).))).
Method 1: RNAfold - direct fold
Energy -67.2 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Tremellomycetes see NCBI Taxonomy
Tremellales see NCBI Taxonomy
Tremellaceae see NCBI Taxonomy
Filobasidiella see NCBI Taxonomy
mitosporic Filobasidiella see NCBI Taxonomy
Cryptococcus amylolentus see NCBI Taxonomy
20378367 (Method 2) see NCBI Nucleotide
223047808 (Method 2) see NCBI Nucleotide
Filobasidiella/Cryptococcus neoformans species complex see NCBI Taxonomy
Cryptococcus neoformans see NCBI Taxonomy
304471 (Method 2) see NCBI Nucleotide
303387591 (Method 2) see NCBI Nucleotide
314914292 (Method 2) see NCBI Nucleotide
Cryptococcus gattii see NCBI Taxonomy
304472 (Method 2) see NCBI Nucleotide
mitosporic Tremellales see NCBI Taxonomy
Tsuchiyaea see NCBI Taxonomy
Tsuchiyaea wingfieldii see NCBI Taxonomy
20378388 (Method 2) see NCBI Nucleotide
223047822 (Method 2) see NCBI Nucleotide
Cryptococcus see NCBI Taxonomy
Cryptococcus heveanensis see NCBI Taxonomy
20378362 (Method 2) see NCBI Nucleotide
223047811 (Method 2) see NCBI Nucleotide
291195591 (Method 2) see NCBI Nucleotide
291195592 (Method 2) see NCBI Nucleotide
291195593 (Method 2) see NCBI Nucleotide
291195594 (Method 2) see NCBI Nucleotide
291195595 (Method 2) see NCBI Nucleotide
291195596 (Method 2) see NCBI Nucleotide
291195599 (Method 2) see NCBI Nucleotide
291195600 (Method 2) see NCBI Nucleotide
291195601 (Method 2) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 287
End: 483

If you use the database please cite.