Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 148807690

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 148807690 see NCBI Nucleotide
Accession EF608059
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Fungi/Metazoa group ; Fungi ; Dikarya ; Ascomycota ; saccharomyceta ; Pezizomycotina ; leotiomyceta ; sordariomyceta ; Sordariomycetes ; Hypocreomycetidae ; Hypocreomycetidae incertae sedis ; Glomerellaceae ; Glomerella ; Glomerella lindemuthiana 
Sequence ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTCGACGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGTAAAACCCCCCAATTTTTCAAGGTTGA
Structure ....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((.((((((.(((...((((.((((.((..((.....))))))))..)))))))))))))....))))))....)))...(((((......))))).
Method 1: RNAfold - direct fold
Energy -52 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
unclassified Fungi see NCBI Taxonomy
fungal endophyte sp. AP411 see NCBI Taxonomy
317415371 (Method 2) see NCBI Nucleotide
fungal endophyte sp. P1921A see NCBI Taxonomy
220967506 (Method 2) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Ascomycota see NCBI Taxonomy
saccharomyceta see NCBI Taxonomy
Pezizomycotina see NCBI Taxonomy
leotiomyceta see NCBI Taxonomy
sordariomyceta see NCBI Taxonomy
Sordariomycetes see NCBI Taxonomy
Hypocreomycetidae see NCBI Taxonomy
Hypocreomycetidae incertae sedis see NCBI Taxonomy
Glomerellaceae see NCBI Taxonomy
Glomerella see NCBI Taxonomy
Glomerella cingulata see NCBI Taxonomy
2569 (Method 2) see NCBI Nucleotide
Glomerella acutata see NCBI Taxonomy
96776053 (Method 2) see NCBI Nucleotide
111414353 (Method 2) see NCBI Nucleotide
121487785 (Method 2) see NCBI Nucleotide
154125140 (Method 2) see NCBI Nucleotide
154125141 (Method 2) see NCBI Nucleotide
154125142 (Method 2) see NCBI Nucleotide
154125154 (Method 2) see NCBI Nucleotide
157072719 (Method 2) see NCBI Nucleotide
157072723 (Method 2) see NCBI Nucleotide
157072724 (Method 2) see NCBI Nucleotide
157072725 (Method 2) see NCBI Nucleotide
157072726 (Method 2) see NCBI Nucleotide
157072727 (Method 2) see NCBI Nucleotide
157072728 (Method 2) see NCBI Nucleotide
157072729 (Method 2) see NCBI Nucleotide
157072730 (Method 2) see NCBI Nucleotide
160268835 (Method 2) see NCBI Nucleotide
209978369 (Method 2) see NCBI Nucleotide
215400991 (Method 2) see NCBI Nucleotide
215400993 (Method 2) see NCBI Nucleotide
215400994 (Method 2) see NCBI Nucleotide
215400996 (Method 2) see NCBI Nucleotide
215401001 (Method 2) see NCBI Nucleotide
215401007 (Method 2) see NCBI Nucleotide
262212669 (Method 2) see NCBI Nucleotide
mitosporic Glomerellaceae see NCBI Taxonomy
Colletotrichum see NCBI Taxonomy
Colletotrichum sp. see NCBI Taxonomy
23477068 (Method 2) see NCBI Nucleotide
Colletotrichum sp. TNOS3 see NCBI Taxonomy
23477059 (Method 2) see NCBI Nucleotide
Colletotrichum lupini see NCBI Taxonomy
17426620 (Method 2) see NCBI Nucleotide
17426622 (Method 2) see NCBI Nucleotide
17426627 (Method 2) see NCBI Nucleotide
17426631 (Method 2) see NCBI Nucleotide
17426632 (Method 2) see NCBI Nucleotide
17426634 (Method 2) see NCBI Nucleotide
17426637 (Method 2) see NCBI Nucleotide
17426638 (Method 2) see NCBI Nucleotide
17426639 (Method 2) see NCBI Nucleotide
17426652 (Method 2) see NCBI Nucleotide
17426663 (Method 2) see NCBI Nucleotide
17426669 (Method 2) see NCBI Nucleotide
17426676 (Method 2) see NCBI Nucleotide
82799369 (Method 2) see NCBI Nucleotide
82799371 (Method 2) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 356
End: 520

If you use the database please cite.