The ITS2 database

GI 158535946

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 158535946

Accession EF652485

Date 2011/04/01

Lineage root ; cellular organisms ; Eukaryota ; Fungi/Metazoa group ; Fungi ; Dikarya ; Ascomycota ; saccharomyceta ; Pezizomycotina ; leotiomyceta ; Eurotiomycetes ; Eurotiomycetidae ; Eurotiales ; Trichocomaceae ; mitosporic Trichocomaceae ; Aspergillus ; Aspergillus subsessilis

Sequence ATTGCTGTCCCTCAAGCCCGGCTTGTGTGATGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGATTAGGGCCGGCCGGGCGCCAGCCGGCGTCATCAATCTTATTTTTCAGGTT

Structure ......(((...(((((...)))))...)))(((((..(((((((....))))))))))))....(((..(((((((.(((.(.((((((((((((((...(((((...))).)))))))))...)))))))))))..))).))))..)))...(((((........)))))

Method 1: RNAfold - direct fold

Energy -66 kcal/mol

Model for

root

cellular organisms

Eukaryota

Viridiplantae

Streptophyta

Streptophytina

Embryophyta

Tracheophyta

Euphyllophyta

Spermatophyta

Magnoliophyta

magnoliids

Laurales

Lauraceae

Lindera

Lindera tienchuanensis

30349754 (Method 2)

Neolitsea

Neolitsea confertifolia

30349742 (Method 2)

Sinosassafras

Sinosassafras flavinervia

30349736 (Method 2)

Fungi/Metazoa group

Fungi

environmental samples

uncultured fungus

82704064 (Method 2)

82704078 (Method 2)

255672717 (Method 2)

255672718 (Method 2)

255672722 (Method 2)

255672724 (Method 2)

256855645 (Method 2)

256855646 (Method 2)

284934124 (Method 2)

284934463 (Method 2)

284941812 (Method 2)

299767580 (Method 2)

299767583 (Method 2)

299767584 (Method 2)

299767586 (Method 2)

299767587 (Method 2)

299767619 (Method 2)

299767620 (Method 2)

299767726 (Method 2)

299767876 (Method 2)

299767877 (Method 2)

uncultured endophytic fungus

228015649 (Method 2)

228015656 (Method 2)

315139363 (Method 2)

uncultured compost fungus

218473049 (Method 2)

unclassified Fungi

fungal endophyte

193246194 (Method 2)

239509259 (Method 2)

239509265 (Method 2)

fungal sp. CB21

190411031 (Method 2)

fungal sp. CB24

190411032 (Method 2)

fungal sp. CB30_L3

190411043 (Method 2)

fungal sp. CB32

190411038 (Method 2)

fungal sp. CB35_(5S)

190411037 (Method 2)

fungal sp. CB36_(5A)

190411036 (Method 2)

fungal sp. Pinero10

190411048 (Method 2)

fungal sp. Pinero7II

190411047 (Method 2)

fungal endophyte sp. ST22

209915953 (Method 2)

fungal sp. S6-1

224830293 (Method 2)

fungal sp. 3478 YZ-2011

325296197 (Method 2)

Dikarya

Ascomycota

unclassified Ascomycota

ascomycete sp. MA4

116282708 (Method 2)

ascomycete sp. GP7

116282702 (Method 2)

Ascomycota sp. H-13

229597474 (Method 2)

Ascomycota sp. H-17

229597487 (Method 2)

saccharomyceta

Pezizomycotina

leotiomyceta

Eurotiomycetes

Eurotiomycetidae

Eurotiales

Trichocomaceae

Emericella

Emericella variecolor

3757577 (Method 2)

119359827 (Method 2)

158535887 (Method 2)

158535892 (Method 2)

237626013 (Method 2)

327314948 (Method 2)

Emericella desertorum

158535966 (Method 2)

Emericella fruticulosa

119359812 (Method 2)

158535944 (Method 2)

241914445 (Method 2)

Emericella echinulata

119359809 (Method 2)

158535906 (Method 2)

Emericella striata

119359823 (Method 2)

Emericella astellata

119359831 (Method 2)

158535908 (Method 2)

Emericella quadrilineata

3757576 (Method 2)

3757579 (Method 2)

3757580 (Method 2)

34809369 (Method 2)

37786123 (Method 2)

37786124 (Method 2)

37786125 (Method 2)

37786126 (Method 2)

119359836 (Method 2)

119359844 (Method 2)

119698411 (Method 2)

158535894 (Method 2)

158535905 (Method 2)

158535925 (Method 2)

158535927 (Method 2)

158535945 (Method 2)

158535954 (Method 2)

296687068 (Method 2)

Emericella rugulosa

34809372 (Method 2)

84458461 (Method 2)

119359819 (Method 2)

119359820 (Method 2)

119359845 (Method 2)

158535895 (Method 2)

162415951 (Method 2)

164611777 (Method 2)

164611781 (Method 2)

164611785 (Method 2)

258618722 (Method 2)

314947172 (Method 2)

315131424 (Method 2)

Emericella rugulosa var. lazulina

Emericella violacea

119359828 (Method 2)

119359837 (Method 2)

158535899 (Method 2)

158535923 (Method 2)

Emericella acristata

119359805 (Method 2)

158535907 (Method 2)

Emericella parvathecia

101919144 (Method 2)

Emericella dentata

119359808 (Method 2)

119359838 (Method 2)

119359842 (Method 2)

119359843 (Method 2)

158535949 (Method 2)

Emericella indica

3757581 (Method 2)

Emericella navahoensis

119359834 (Method 2)

158535885 (Method 2)

Emericella sublata

119359824 (Method 2)

Emericella nidulans

2315 (Method 2)

424139 (Method 2)

2072177 (Method 2)

4927230 (Method 2)

7208819 (Method 2)

21666933 (Method 2)

34809368 (Method 2)

38427151 (Method 2)

91680620 (Method 2)

101919136 (Method 2)

119359814 (Method 2)

119359835 (Method 2)

134143188 (Method 2)

142882750 (Method 2)

146454424 (Method 2)

146454425 (Method 2)

148535447 (Method 2)

148535448 (Method 2)

148535449 (Method 2)

148535450 (Method 2)

148535451 (Method 2)

158535888 (Method 2)

158535919 (Method 2)

161789589 (Method 2)

163962502 (Method 2)

166203651 (Method 2)

193245483 (Method 2)

193245493 (Method 2)

237626006 (Method 2)

237626007 (Method 2)

237626008 (Method 2)

237626009 (Method 2)

237626010 (Method 2)

237626012 (Method 2)

258618716 (Method 2)

281183739 (Method 2)

310770505 (Method 2)

315131415 (Method 2)

315131420 (Method 2)

315131421 (Method 2)

318101585 (Method 2)

322422274 (Method 2)

Emericella nidulans var. lata

Emericella nidulans var. nidulans

Emericella corrugata

119359818 (Method 2)

119359852 (Method 2)

119359971 (Method 2)

119359972 (Method 2)

119359973 (Method 2)

119359974 (Method 2)

119359975 (Method 2)

Emericella cleistominuta

119359832 (Method 2)

Emericella sp. Rs1

56377724 (Method 2)

Emericella venezuelensis

62147572 (Method 2)

Emericella miyajii

101919140 (Method 2)

Emericella appendiculata

119359806 (Method 2)

119359840 (Method 2)

119359846 (Method 2)

Emericella falconensis

119359810 (Method 2)

119359847 (Method 2)

Emericella omanensis

119359815 (Method 2)

119359848 (Method 2)

Emericella qinqixianii

119359817 (Method 2)

119359841 (Method 2)

119359849 (Method 2)

119359850 (Method 2)

119359851 (Method 2)

Emericella similis

119359822 (Method 2)

119359839 (Method 2)

Emericella undulata

119359825 (Method 2)

Emericella sp. IFM 54239

119359855 (Method 2)

Emericella sp. IFM 54215

119359856 (Method 2)

Emericella sp. IFM 54240

119359857 (Method 2)

Emericella sp. IFM 54241

119359858 (Method 2)

Emericella sp. IFM 54217

119359859 (Method 2)

Emericella sp. IFM 54273

119359860 (Method 2)

Emericella sp. IFM 54245

119359861 (Method 2)

Emericella sp. NRRL 2241

158535900 (Method 2)

Emericella sp. HZ-17

162415954 (Method 2)

Emericella sp. SS-S10

291361454 (Method 2)

Emericella sp. FppMV

314947162 (Method 2)

Emericella sp. pp7

314947180 (Method 2)

Byssochlamys

Byssochlamys nivea

253993233 (Method 2)

Byssochlamys spectabilis

194022402 (Method 2)

238822205 (Method 2)

242263588 (Method 2)

Paecilomyces variotii

194022402 (Method 2)

238822205 (Method 2)

242263588 (Method 2)

Talaromyces

Talaromyces flavus

158138922 (Method 2)

mitosporic Trichocomaceae

Aspergillus

Aspergillus flavus

65331875 (Method 2)

Aspergillus unguis

237625991 (Method 2)

Aspergillus ustus

15706253 (Method 2)

15706255 (Method 2)

21666967 (Method 2)

34809354 (Method 2)

34809355 (Method 2)

34809356 (Method 2)

34809358 (Method 2)

37786118 (Method 2)

37786119 (Method 2)

89113002 (Method 2)

134143185 (Method 2)

162285937 (Method 2)

189543387 (Method 2)

237625994 (Method 2)

237625995 (Method 2)

261277531 (Method 2)

294847813 (Method 2)

296687088 (Method 2)

302138541 (Method 2)

311295016 (Method 2)

315110851 (Method 2)

Aspergillus carneus

218454082 (Method 2)

324499398 (Method 2)

Aspergillus recurvatus

158535943 (Method 2)

Aspergillus versicolor

34809360 (Method 2)

34809363 (Method 2)

52630848 (Method 2)

82491499 (Method 2)

82491500 (Method 2)

82491502 (Method 2)

84796526 (Method 2)

85375914 (Method 2)

91680616 (Method 2)

157100988 (Method 2)

158530184 (Method 2)

158530185 (Method 2)

158535903 (Method 2)

158535910 (Method 2)

158535939 (Method 2)

158535941 (Method 2)

162285932 (Method 2)

169639297 (Method 2)

182375391 (Method 2)

189543397 (Method 2)

194368385 (Method 2)

194371379 (Method 2)

220898252 (Method 2)

221164161 (Method 2)

237625989 (Method 2)

237625990 (Method 2)

237625992 (Method 2)

241017331 (Method 2)

253721875 (Method 2)

282935983 (Method 2)

283857175 (Method 2)

299891156 (Method 2)

310787949 (Method 2)

315131412 (Method 2)

315131425 (Method 2)

325512976 (Method 2)

Aspergillus sydowii

27524890 (Method 2)

27524891 (Method 2)

27524893 (Method 2)

27524894 (Method 2)

27524895 (Method 2)

27524896 (Method 2)

34809348 (Method 2)

34809349 (Method 2)

83627174 (Method 2)

84796525 (Method 2)

89113001 (Method 2)

89113005 (Method 2)

89113009 (Method 2)

89113017 (Method 2)

89475576 (Method 2)

90968049 (Method 2)

90968050 (Method 2)

91680612 (Method 2)

134143184 (Method 2)

142882754 (Method 2)

157100987 (Method 2)

157100990 (Method 2)

157100991 (Method 2)

157100992 (Method 2)

157100993 (Method 2)

157100996 (Method 2)

158535911 (Method 2)

158535912 (Method 2)

158535934 (Method 2)

163962501 (Method 2)

170779273 (Method 2)

193245492 (Method 2)

194371405 (Method 2)

194371408 (Method 2)

194371424 (Method 2)

194371446 (Method 2)

199653166 (Method 2)

205277766 (Method 2)

217315802 (Method 2)

221164158 (Method 2)

225794711 (Method 2)

253721871 (Method 2)

254681468 (Method 2)

282555053 (Method 2)

284438208 (Method 2)

297382555 (Method 2)

300076916 (Method 2)

310787700 (Method 2)

315131414 (Method 2)

315131419 (Method 2)

315131423 (Method 2)

315131426 (Method 2)

315201017 (Method 2)

315201019 (Method 2)

315318905 (Method 2)

325512977 (Method 2)

Aspergillus caespitosus

34809321 (Method 2)

146454426 (Method 2)

158535889 (Method 2)

285020454 (Method 2)

Aspergillus pseudodeflectus

112418354 (Method 2)

156891066 (Method 2)

158535917 (Method 2)

158535968 (Method 2)

285027691 (Method 2)

Aspergillus spelunceus

158535951 (Method 2)

158535952 (Method 2)

315131428 (Method 2)

315131429 (Method 2)

Aspergillus varians

158535940 (Method 2)

Aspergillus alliaceus

158144428 (Method 2)

158144436 (Method 2)

158144452 (Method 2)

262072537 (Method 2)

Aspergillus sp. ZL1097

82491518 (Method 2)

Aspergillus sp. ZL1080

82491519 (Method 2)

Aspergillus sp. GP3

116282699 (Method 2)

Aspergillus sp. KER4

124289130 (Method 2)

Aspergillus calidoustus

158535913 (Method 2)

315131433 (Method 2)

315131434 (Method 2)

315131436 (Method 2)

315131437 (Method 2)

Aspergillus insuetus

158535918 (Method 2)

227452698 (Method 2)

237625993 (Method 2)

315131430 (Method 2)

315131435 (Method 2)

Aspergillus minutus

158535942 (Method 2)

Aspergillus protuberus

158535921 (Method 2)

Aspergillus striatus

158535931 (Method 2)

285020460 (Method 2)

Aspergillus variecolor

158535932 (Method 2)

318101586 (Method 2)

Aspergillus sp. Vega294

157697371 (Method 2)

Aspergillus sp. Vega344

157697369 (Method 2)

Aspergillus sp. Vega187

157986197 (Method 2)

Aspergillus sp. BF8

163257606 (Method 2)

Aspergillus sp. F62

225032529 (Method 2)

Aspergillus sp. HLS109

225580723 (Method 2)

Aspergillus sp. F-3

239923300 (Method 2)

Aspergillus sp. N10

240129391 (Method 2)

Aspergillus sp. N22

240129402 (Method 2)

Aspergillus sp. N23

240129403 (Method 2)

Aspergillus sp. N26

240129406 (Method 2)

Aspergillus sp. N27

240129407 (Method 2)

Aspergillus sp. N31

240129411 (Method 2)

Aspergillus sp. KMD 901

253910929 (Method 2)

Aspergillus sp. NH73

291059124 (Method 2)

Aspergillus sp. RF161

291508718 (Method 2)

Aspergillus sp. SF50

291508703 (Method 2)

Aspergillus sp. ASR-106

296840376 (Method 2)

Aspergillus sp. M15

302179993 (Method 2)

Aspergillus sp. Da91

302703827 (Method 2)

Aspergillus sp. Ghr2

302635615 (Method 2)

Aspergillus sp. E6814a

304333848 (Method 2)

Aspergillus sp. BEA-2010

306850922 (Method 2)

Aspergillus sp. 4-1

310787942 (Method 2)

Aspergillus sp. 6-6

312205534 (Method 2)

Aspergillus sp. A-13

312205537 (Method 2)

Aspergillus sp. A-18

312205538 (Method 2)

Aspergillus sp. G-3

312205547 (Method 2)

Aspergillus sp. G-7

312205548 (Method 2)

Aspergillus sp. JZ-109

315201018 (Method 2)

Aspergillus sp. JZ-41

315201015 (Method 2)

Aspergillus sp. Lf357

315142909 (Method 2)

Aspergillus sp. JZ-38

315201016 (Method 2)

Aspergillus sp. LH-CAF3

321272562 (Method 2)

Aspergillus sp. BMP2945

323651402 (Method 2)

Aspergillus sp. BMP3039

323651407 (Method 2)

Penicillium

Penicillium camemberti

89113015 (Method 2)

Penicillium citrinum

89113020 (Method 2)

Penicillium funiculosum

254973560 (Method 2)

281021284 (Method 2)

Penicillium aculeatum

156145898 (Method 2)

296142156 (Method 2)

Penicillium pinophilum

10179442 (Method 2)

63093879 (Method 2)

189047028 (Method 2)

209360736 (Method 2)

251734366 (Method 2)

285265356 (Method 2)

291293632 (Method 2)

291498385 (Method 2)

291498388 (Method 2)

291498390 (Method 2)

291498404 (Method 2)

291498433 (Method 2)

294861888 (Method 2)

311335536 (Method 2)

317574100 (Method 2)

321531578 (Method 2)

326579940 (Method 2)

Penicillium verruculosum

21239409 (Method 2)

194592253 (Method 2)

296245058 (Method 2)

315201007 (Method 2)

326579942 (Method 2)

327360211 (Method 2)

Penicillium sp. EU0013

58219313 (Method 2)

Penicillium sp. 22-M-5

156145886 (Method 2)

Penicillium sp. E75-3-2

161343965 (Method 2)

Penicillium sp. HZ-4

162415942 (Method 2)

Penicillium sp. QLF43

205277702 (Method 2)

Penicillium sp. OY12007

221164194 (Method 2)

Penicillium sp. 1-95

225355236 (Method 2)

Penicillium sp. M73

289655930 (Method 2)

Penicillium sp. NH7

291059125 (Method 2)

Penicillium sp. ASR-217

296840462 (Method 2)

Penicillium sp. ASR-26

296840319 (Method 2)

Penicillium sp. H3

312192489 (Method 2)

Penicillium sp. J1

312192488 (Method 2)

Penicillium sp. CRCF12

317183693 (Method 2)

Penicillium sp. CRCF6

317183687 (Method 2)

Penicillium sp. MJM1981

317574113 (Method 2)

Penicillium sp. V2Z

323574360 (Method 2)

Penicillium sp. BMP2894

323651435 (Method 2)

Penicillium sp. BMP2937

323651436 (Method 2)

Penicillium sp. S70

326486738 (Method 2)

Paecilomyces

Paecilomyces sinensis

168829582 (Method 2)

241017364 (Method 2)

Paecilomyces formosus

240000061 (Method 2)

299818322 (Method 2)

299818325 (Method 2)

299818326 (Method 2)

299818344 (Method 2)

Thysanophora

Thysanophora penicillioides

74038511 (Method 2)

Petromyces

Petromyces alliaceus

158144433 (Method 2)

158144441 (Method 2)

Petromyces albertensis

3925704 (Method 2)

environmental samples

uncultured Aspergillus

190350703 (Method 2)

238805277 (Method 2)

315139364 (Method 2)

uncultured Penicillium

110734412 (Method 2)

208007582 (Method 2)

238805271 (Method 2)

238805276 (Method 2)

323574373 (Method 2)

323574378 (Method 2)

uncultured Emericella

322718682 (Method 2)

unclassified Eurotiales

Eurotiales sp. K4Ri74H

300079055 (Method 2)

environmental samples

uncultured Eurotiales

312207012 (Method 2)

312207014 (Method 2)

Onygenales

Ascosphaeraceae

Ascosphaera

Ascosphaera aggregata

3513434 (Method 2)

Arachnomycetaceae

Arachnomyces

Arachnomyces minimus

56961702 (Method 2)

dothideomyceta

Dothideomycetes

Dothideomycetidae

Capnodiales

mitosporic Capnodiales

Ramichloridium

Ramichloridium cerophilum

241914444 (Method 2)

sordariomyceta

Sordariomycetes

Hypocreomycetidae

Hypocreales

Hypocreaceae

mitosporic Hypocreaceae

Trichoderma

Trichoderma atroviride

189162075 (Method 2)

Tricoderma viride species complex

Trichoderma viride

76593945 (Method 2)

mitosporic Hypocreales

Cephalosporium

Cephalosporium sp. JS2099

83627141 (Method 2)

environmental samples

uncultured Hypocreaceae

110734411 (Method 2)

Sordariomycetidae

Sordariales

mitosporic Sordariales

Paecilomyces

Paecilomyces sp. JS1185

83627195 (Method 2)

Paecilomyces sp. JS2106

83627140 (Method 2)

Magnaporthales

Magnaporthaceae

mitosporic Magnaporthaceae

Phialophora

Phialophora alba

298683527 (Method 2)

Basidiomycota

Agaricomycotina

Tremellomycetes

Tremellales

mitosporic Tremellales

Hyalodendron

Hyalodendron sp. JS1075

83627139 (Method 2)

Annotation Process: HMM annotation
Start: 317
End: 488

If you use the database please cite.