Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 176063

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 176063 see NCBI Nucleotide
Accession M91616
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Fungi/Metazoa group ; Fungi ; Dikarya ; Basidiomycota ; Agaricomycotina ; Agaricomycetes ; Agaricomycetidae ; Boletales ; Suillineae ; Suillaceae ; Suillus ; Suillus grevillei 
Sequence AGTAAATTCTCAACCCCTCTCGATTTGCTTCGAAAGGGTGCTTGGATAGTGGGGGCTGCCGGAGATCTGGACTTCTCGTCTAGGACTCGGGCTCTCCTGAAATGAATGGGCCTGCGGTCGACTTTCGACTATGCATGACAAGGCTTTTGGCGTGATAATGATCGCCGCTCGCTGAAGTGCATGAATGAATGGTCCCGTGCCTCTAATGTGTCGATGCCTTCTGGCGTCTTCCTTATTGACTTTTGA
Structure .........((((.((((.((((......)))).))))...)))).....(((((..(((.(((.(((((((.....))))))).))).))).))))).........((((..((((..((((((((..(((((((.....(((....((((((((....)))).)))).)))...)))))))..)))).)))))))))))).(((((....((((((....)))))).....)))))........
Method 1: RNAfold - direct fold
Energy -75.5 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured fungus see NCBI Taxonomy
219814155 (Method 2) see NCBI Nucleotide
299778149 (Method 2) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetidae see NCBI Taxonomy
Boletales see NCBI Taxonomy
Suillineae see NCBI Taxonomy
Rhizopogonaceae see NCBI Taxonomy
Rhizopogon see NCBI Taxonomy
Rhizopogon evadens see NCBI Taxonomy
18077772 (Method 2) see NCBI Nucleotide
Rhizopogon rubescens see NCBI Taxonomy
121487805 (Method 2) see NCBI Nucleotide
Rhizopogon semireticulatus see NCBI Taxonomy
194304167 (Method 2) see NCBI Nucleotide
Rhizopogon smithii see NCBI Taxonomy
5453409 (Method 2) see NCBI Nucleotide
Rhizopogon subgelatinosus see NCBI Taxonomy
18077782 (Method 2) see NCBI Nucleotide
Rhizopogon bacillisporus see NCBI Taxonomy
194304162 (Method 2) see NCBI Nucleotide
Suillaceae see NCBI Taxonomy
Suillus see NCBI Taxonomy
Suillus brevipes see NCBI Taxonomy
226442281 (Method 2) see NCBI Nucleotide
Suillus lakei see NCBI Taxonomy
86610840 (Method 2) see NCBI Nucleotide
87115957 (Method 2) see NCBI Nucleotide
171879759 (Method 2) see NCBI Nucleotide
Suillus tridentinus see NCBI Taxonomy
40644225 (Method 2) see NCBI Nucleotide
Suillus sp. 'Cooke-53119' see NCBI Taxonomy
1916681 (Method 2) see NCBI Nucleotide
Suillus viscidus see NCBI Taxonomy
157056448 (Method 2) see NCBI Nucleotide
Suillus aeruginascens see NCBI Taxonomy
10637998 (Method 2) see NCBI Nucleotide
Suillus amabilis see NCBI Taxonomy
305676762 (Method 2) see NCBI Nucleotide
environmental samples see NCBI Taxonomy
uncultured Suillaceae see NCBI Taxonomy
85700696 (Method 2) see NCBI Nucleotide
uncultured Suillus see NCBI Taxonomy
150035551 (Method 2) see NCBI Nucleotide
219812509 (Method 2) see NCBI Nucleotide
219812538 (Method 2) see NCBI Nucleotide
219812585 (Method 2) see NCBI Nucleotide
219812620 (Method 2) see NCBI Nucleotide
219812635 (Method 2) see NCBI Nucleotide
219812656 (Method 2) see NCBI Nucleotide
219812674 (Method 2) see NCBI Nucleotide
219812698 (Method 2) see NCBI Nucleotide
219812705 (Method 2) see NCBI Nucleotide
219812712 (Method 2) see NCBI Nucleotide
219812714 (Method 2) see NCBI Nucleotide
219812745 (Method 2) see NCBI Nucleotide
219812779 (Method 2) see NCBI Nucleotide
219812799 (Method 2) see NCBI Nucleotide
219812882 (Method 2) see NCBI Nucleotide
219812895 (Method 2) see NCBI Nucleotide
219812906 (Method 2) see NCBI Nucleotide
219812915 (Method 2) see NCBI Nucleotide
219812920 (Method 2) see NCBI Nucleotide
219812983 (Method 2) see NCBI Nucleotide
219812994 (Method 2) see NCBI Nucleotide
219813030 (Method 2) see NCBI Nucleotide
219813111 (Method 2) see NCBI Nucleotide
219813114 (Method 2) see NCBI Nucleotide
219813150 (Method 2) see NCBI Nucleotide
219813181 (Method 2) see NCBI Nucleotide
219813206 (Method 2) see NCBI Nucleotide
219813278 (Method 2) see NCBI Nucleotide
219813280 (Method 2) see NCBI Nucleotide
219813284 (Method 2) see NCBI Nucleotide
219813340 (Method 2) see NCBI Nucleotide
219813413 (Method 2) see NCBI Nucleotide
219813509 (Method 2) see NCBI Nucleotide
219813530 (Method 2) see NCBI Nucleotide
219813585 (Method 2) see NCBI Nucleotide
219813597 (Method 2) see NCBI Nucleotide
219813601 (Method 2) see NCBI Nucleotide
219813647 (Method 2) see NCBI Nucleotide
219813716 (Method 2) see NCBI Nucleotide
219813760 (Method 2) see NCBI Nucleotide
219813859 (Method 2) see NCBI Nucleotide
219813899 (Method 2) see NCBI Nucleotide
219813936 (Method 2) see NCBI Nucleotide
219813976 (Method 2) see NCBI Nucleotide
219814012 (Method 2) see NCBI Nucleotide
219814033 (Method 2) see NCBI Nucleotide
219814044 (Method 2) see NCBI Nucleotide
219814078 (Method 2) see NCBI Nucleotide
219814116 (Method 2) see NCBI Nucleotide
219814167 (Method 2) see NCBI Nucleotide
219814195 (Method 2) see NCBI Nucleotide
225355317 (Method 2) see NCBI Nucleotide
284011097 (Method 2) see NCBI Nucleotide
298359567 (Method 2) see NCBI Nucleotide
298359572 (Method 2) see NCBI Nucleotide
298359582 (Method 2) see NCBI Nucleotide
298360975 (Method 2) see NCBI Nucleotide
298360976 (Method 2) see NCBI Nucleotide
298360992 (Method 2) see NCBI Nucleotide
298361022 (Method 2) see NCBI Nucleotide
299766330 (Method 2) see NCBI Nucleotide
310690050 (Method 2) see NCBI Nucleotide
310690051 (Method 2) see NCBI Nucleotide
310690053 (Method 2) see NCBI Nucleotide
310690054 (Method 2) see NCBI Nucleotide
310690055 (Method 2) see NCBI Nucleotide
310690056 (Method 2) see NCBI Nucleotide
environmental samples see NCBI Taxonomy
uncultured Agaricomycotina see NCBI Taxonomy
219812914 (Method 2) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 374
End: 619

If you use the database please cite.