Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 4321165

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 4321165 see NCBI Nucleotide
Accession AF007478
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Viridiplantae ; Streptophyta ; Streptophytina ; Embryophyta ; Tracheophyta ; Euphyllophyta ; Spermatophyta ; Magnoliophyta ; eudicotyledons ; core eudicotyledons ; rosids ; fabids ; Fabales ; Fabaceae ; Papilionoideae ; Genisteae ; Lupinus ; Lupinus luteus 
Sequence GCACATCGTTGCCCCCGTGCCTTGGCCACGTGCCAGGCACGAAGCGGGGCGAATGTTGGCTTCCCGGGAGCAATGTCTCACGGTTGGTTGAAAACTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGCTAAAGCTCGAGACCGGTCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTTTGACCCATGGGGGTCTGTTGGCCTCCTAATACGGGAACCTCAGG
Structure ((.((...((((((((((((((.(((.....))))))))))....)))))))....))))...(((.(((......))).)))..(((((((....(((((.(((((((.(((.((((((..((.((((...(((((....)))))..)))).)).)))).))..)))))))).)).....))))))))))))..(((((.(((((.((...))....)))))..)))))..
Method 1: RNAfold - direct fold
Energy -81.6 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Viridiplantae see NCBI Taxonomy
Streptophyta see NCBI Taxonomy
Streptophytina see NCBI Taxonomy
Embryophyta see NCBI Taxonomy
Tracheophyta see NCBI Taxonomy
Euphyllophyta see NCBI Taxonomy
Spermatophyta see NCBI Taxonomy
Magnoliophyta see NCBI Taxonomy
eudicotyledons see NCBI Taxonomy
core eudicotyledons see NCBI Taxonomy
rosids see NCBI Taxonomy
fabids see NCBI Taxonomy
Fabales see NCBI Taxonomy
Fabaceae see NCBI Taxonomy
Papilionoideae see NCBI Taxonomy
Genisteae see NCBI Taxonomy
Lupinus see NCBI Taxonomy
Lupinus polyphyllus see NCBI Taxonomy
4321183 (Method 2) see NCBI Nucleotide
Lupinus texensis see NCBI Taxonomy
4321161 (Method 2) see NCBI Nucleotide
Lupinus albifrons see NCBI Taxonomy
3097932 (Method 2) see NCBI Nucleotide
3097933 (Method 2) see NCBI Nucleotide
Lupinus arcticus see NCBI Taxonomy
4321182 (Method 2) see NCBI Nucleotide
Lupinus argenteus see NCBI Taxonomy
3097938 (Method 2) see NCBI Nucleotide
3097939 (Method 2) see NCBI Nucleotide
Lupinus elegans see NCBI Taxonomy
3097944 (Method 2) see NCBI Nucleotide
3097945 (Method 2) see NCBI Nucleotide
Lupinus hispanicus see NCBI Taxonomy
3098033 (Method 2) see NCBI Nucleotide
3098034 (Method 2) see NCBI Nucleotide
Lupinus latifolius see NCBI Taxonomy
3097935 (Method 2) see NCBI Nucleotide
3097936 (Method 2) see NCBI Nucleotide
Lupinus microcarpus see NCBI Taxonomy
4321175 (Method 2) see NCBI Nucleotide
4321176 (Method 2) see NCBI Nucleotide
Lupinus microcarpus var. densiflorus see NCBI Taxonomy
Lupinus microcarpus var. microcarpus see NCBI Taxonomy
Lupinus mutabilis see NCBI Taxonomy
4321171 (Method 2) see NCBI Nucleotide
Lupinus nanus see NCBI Taxonomy
3097914 (Method 2) see NCBI Nucleotide
3097915 (Method 2) see NCBI Nucleotide
Lupinus paraguariensis see NCBI Taxonomy
4321163 (Method 2) see NCBI Nucleotide
Lupinus succulentus see NCBI Taxonomy
4321181 (Method 2) see NCBI Nucleotide
Lupinus sericeus see NCBI Taxonomy
3097908 (Method 2) see NCBI Nucleotide
3097909 (Method 2) see NCBI Nucleotide
Lupinus leucophyllus see NCBI Taxonomy
3097917 (Method 2) see NCBI Nucleotide
3097918 (Method 2) see NCBI Nucleotide
Lupinus mexicanus see NCBI Taxonomy
3097920 (Method 2) see NCBI Nucleotide
3097921 (Method 2) see NCBI Nucleotide
Lupinus affinis see NCBI Taxonomy
4321174 (Method 2) see NCBI Nucleotide
Lupinus arizonicus see NCBI Taxonomy
4321170 (Method 2) see NCBI Nucleotide
Lupinus bracteolaris see NCBI Taxonomy
4321160 (Method 2) see NCBI Nucleotide
Lupinus duranii see NCBI Taxonomy
4321180 (Method 2) see NCBI Nucleotide
Lupinus excubitus see NCBI Taxonomy
4321179 (Method 2) see NCBI Nucleotide
Lupinus hirsutissimus see NCBI Taxonomy
4321173 (Method 2) see NCBI Nucleotide
Lupinus lepidus see NCBI Taxonomy
3097923 (Method 2) see NCBI Nucleotide
3097924 (Method 2) see NCBI Nucleotide
4321172 (Method 2) see NCBI Nucleotide
Lupinus lepidus var. aridus see NCBI Taxonomy
Lupinus littoralis see NCBI Taxonomy
3097929 (Method 2) see NCBI Nucleotide
3097930 (Method 2) see NCBI Nucleotide
Lupinus luteolus see NCBI Taxonomy
4321177 (Method 2) see NCBI Nucleotide
Lupinus minimus see NCBI Taxonomy
4321184 (Method 2) see NCBI Nucleotide
Lupinus pusillus see NCBI Taxonomy
4321178 (Method 2) see NCBI Nucleotide
Lupinus sparsiflorus see NCBI Taxonomy
4321169 (Method 2) see NCBI Nucleotide
Lupinus sulphureus see NCBI Taxonomy
3097941 (Method 2) see NCBI Nucleotide
3097942 (Method 2) see NCBI Nucleotide
Lupinus jaime-hintonianus see NCBI Taxonomy
54402285 (Method 2) see NCBI Nucleotide
Annotation Process: Mixed HMM and Genbank annotation
Start: 396
End: 627

If you use the database please cite.