Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 21304891

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 21304891 see NCBI Nucleotide
Accession AF377165
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Fungi/Metazoa group ; Fungi ; Dikarya ; Basidiomycota ; Agaricomycotina ; Agaricomycetes ; Agaricomycetidae ; Boletales ; Suillineae ; Rhizopogonaceae ; Rhizopogon ; Rhizopogon sp. OSC 58561LANF 
Sequence AGTAAATTCTCAACCTCTCTCGATTGACTTCGAGAGGGCGCTTGGATAGTGGAGGTTGCCGGAGACTCGGATTCGTCCGAGATTCGGGCTCTTCTGAAATGCATCGGCTTGCGGACGACTTTCGACTATGTGCGACAAGGCTTTCGGCGTGATAATGATCGCCGTTCGCCGAAGCGCATGACAGAAGGTTCCGTGCCTCTAATGCGTCGACCGCTTACTATCTCTCCGGAGAGAACAGGGTCTTCCTAATTGACTTTTGA
Structure .........((((.(((((((((......)))))))))...)))).....(((((..(((.(((.((((((....)))))).))).))).)))))...((((((.(((..(((((..((((((...(((((((.....(((...(((((..........)))))...)))...)))))))...))))))))))))))....)))))).((((.((.....((((....))))....))))))..................
Method 1: RNAfold - direct fold
Energy -88.9 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured ectomycorrhizal fungus see NCBI Taxonomy
224799066 (Method 2) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetidae see NCBI Taxonomy
Boletales see NCBI Taxonomy
Suillineae see NCBI Taxonomy
Rhizopogonaceae see NCBI Taxonomy
Rhizopogon see NCBI Taxonomy
Rhizopogon subcaerulescens see NCBI Taxonomy
175851 (Method 2) see NCBI Nucleotide
Rhizopogon ellenae see NCBI Taxonomy
18077766 (Method 2) see NCBI Nucleotide
18077798 (Method 2) see NCBI Nucleotide
18077800 (Method 2) see NCBI Nucleotide
Rhizopogon semireticulatus see NCBI Taxonomy
18077762 (Method 2) see NCBI Nucleotide
18077785 (Method 2) see NCBI Nucleotide
193297394 (Method 2) see NCBI Nucleotide
Rhizopogon subpurpurascens see NCBI Taxonomy
18077763 (Method 2) see NCBI Nucleotide
18077774 (Method 2) see NCBI Nucleotide
Rhizopogon diabolicus see NCBI Taxonomy
18077795 (Method 2) see NCBI Nucleotide
18077797 (Method 2) see NCBI Nucleotide
Rhizopogon rocabrunae see NCBI Taxonomy
5762289 (Method 2) see NCBI Nucleotide
5762291 (Method 2) see NCBI Nucleotide
Rhizopogon salebrosus see NCBI Taxonomy
111608708 (Method 2) see NCBI Nucleotide
Rhizopogon arctostaphyli see NCBI Taxonomy
21304893 (Method 2) see NCBI Nucleotide
189098277 (Method 2) see NCBI Nucleotide
Rhizopogon alkalivirens see NCBI Taxonomy
21304880 (Method 2) see NCBI Nucleotide
Rhizopogon guzmanii see NCBI Taxonomy
21304856 (Method 2) see NCBI Nucleotide
Rhizopogon subbadius see NCBI Taxonomy
21304878 (Method 2) see NCBI Nucleotide
Rhizopogon sp. AHF133 see NCBI Taxonomy
21304887 (Method 2) see NCBI Nucleotide
Rhizopogon sp. AHF419 see NCBI Taxonomy
21304866 (Method 2) see NCBI Nucleotide
Rhizopogon sp. Blodgett2285 see NCBI Taxonomy
21304899 (Method 2) see NCBI Nucleotide
Rhizopogon sp. NMHF19 see NCBI Taxonomy
21304864 (Method 2) see NCBI Nucleotide
Rhizopogon sp. NMHF5 see NCBI Taxonomy
21304865 (Method 2) see NCBI Nucleotide
Rhizopogon sp. OSC 49745MT see NCBI Taxonomy
21304879 (Method 2) see NCBI Nucleotide
Rhizopogon sp. OSC 55282MX see NCBI Taxonomy
21304890 (Method 2) see NCBI Nucleotide
Rhizopogon sp. SNF1448 see NCBI Taxonomy
21304901 (Method 2) see NCBI Nucleotide
Rhizopogon sp. SNF1496 see NCBI Taxonomy
21304894 (Method 2) see NCBI Nucleotide
Rhizopogon sp. Siskiyou see NCBI Taxonomy
21304898 (Method 2) see NCBI Nucleotide
Rhizopogon sp. Trappe-8379 see NCBI Taxonomy
21304853 (Method 2) see NCBI Nucleotide
Rhizopogon aff. salebrosus trh542 see NCBI Taxonomy
60203072 (Method 2) see NCBI Nucleotide
Rhizopogon odoratus see NCBI Taxonomy
164510048 (Method 2) see NCBI Nucleotide
Rhizopogon pseudoroseolus see NCBI Taxonomy
254351299 (Method 2) see NCBI Nucleotide
environmental samples see NCBI Taxonomy
uncultured Rhizopogon see NCBI Taxonomy
84039919 (Method 2) see NCBI Nucleotide
84039933 (Method 2) see NCBI Nucleotide
225355314 (Method 2) see NCBI Nucleotide
284011092 (Method 2) see NCBI Nucleotide
295981028 (Method 2) see NCBI Nucleotide
295981030 (Method 2) see NCBI Nucleotide
295981033 (Method 2) see NCBI Nucleotide
298356898 (Method 2) see NCBI Nucleotide
298356899 (Method 2) see NCBI Nucleotide
298356900 (Method 2) see NCBI Nucleotide
304272930 (Method 2) see NCBI Nucleotide
uncultured ectomycorrhiza (Rhizopogon) see NCBI Taxonomy
90568903 (Method 2) see NCBI Nucleotide
90568904 (Method 2) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 415
End: 674

If you use the database please cite.