Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
 		   
Predict
 		   
Model
 		   
Annotate
 		   
Motif
 		   
Tools
 		 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications
ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)

Chlorophyta hypertree
(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

GI 219930312

Figure

(Save as SVG or PNG) view with Pseudoviewer

Details

GI 219930312 see NCBI Nucleotide
Accession FM202864
Date 2011/04/01
Lineage see NCBI Taxonomy root ; cellular organisms ; Eukaryota ; Fungi/Metazoa group ; Fungi ; environmental samples ; uncultured ectomycorrhizal fungus 
Sequence GTGAAATCCTCAAGCTTGGATGGTTTTCCGTCTTAAGCTTGGTATTGGGCTTTGCTGTGCCTTTCGTTGGAACAGCTGGCCTTAAAAGCATTAGCTGATCCTCATGTGGCATTGGTTCTACTCAGCGTGATAATGATATTGACCGCTGGGGACATCTTTCTAGATGGCCAATTCTCTCATCTGGGTTGCTTCTAATTTGGCTTTGACAGATTCTGATCAGAACTGTTTTGCCCTTCTGTTTTGA
Structure (((((.(((((((((((((((((....))))).)))))))))....))).))))).(((((...(((.(((.((((((((.......))..)))))).)))..))).))))).(((...((((((.((((....((.((((.((((((((((....))))))).))).))))))..)))))))))).)))........(((...(((((.((((....)))))))))..)))............
Method 1: RNAfold - direct fold
Energy -69.5 kcal/mol
Model for
root see NCBI Taxonomy
cellular organisms see NCBI Taxonomy
Eukaryota see NCBI Taxonomy
Fungi/Metazoa group see NCBI Taxonomy
Fungi see NCBI Taxonomy
environmental samples see NCBI Taxonomy
uncultured fungus see NCBI Taxonomy
18481578 (Method 3) see NCBI Nucleotide
313761603 (Method 3) see NCBI Nucleotide
313761604 (Method 3) see NCBI Nucleotide
313761605 (Method 3) see NCBI Nucleotide
313761606 (Method 3) see NCBI Nucleotide
313761607 (Method 3) see NCBI Nucleotide
313761608 (Method 3) see NCBI Nucleotide
313761609 (Method 3) see NCBI Nucleotide
313761610 (Method 3) see NCBI Nucleotide
313761611 (Method 3) see NCBI Nucleotide
313761612 (Method 3) see NCBI Nucleotide
313761613 (Method 3) see NCBI Nucleotide
313761614 (Method 3) see NCBI Nucleotide
313761615 (Method 3) see NCBI Nucleotide
313761616 (Method 3) see NCBI Nucleotide
313761617 (Method 3) see NCBI Nucleotide
313761618 (Method 3) see NCBI Nucleotide
313761619 (Method 3) see NCBI Nucleotide
313761620 (Method 3) see NCBI Nucleotide
313761621 (Method 3) see NCBI Nucleotide
313761622 (Method 3) see NCBI Nucleotide
313761623 (Method 3) see NCBI Nucleotide
313761624 (Method 3) see NCBI Nucleotide
313761625 (Method 3) see NCBI Nucleotide
313761626 (Method 3) see NCBI Nucleotide
313761627 (Method 3) see NCBI Nucleotide
313761628 (Method 3) see NCBI Nucleotide
313761629 (Method 3) see NCBI Nucleotide
313761630 (Method 3) see NCBI Nucleotide
313761631 (Method 3) see NCBI Nucleotide
313761632 (Method 3) see NCBI Nucleotide
313761633 (Method 3) see NCBI Nucleotide
313761634 (Method 3) see NCBI Nucleotide
313761635 (Method 3) see NCBI Nucleotide
313761636 (Method 3) see NCBI Nucleotide
313761637 (Method 3) see NCBI Nucleotide
313761638 (Method 3) see NCBI Nucleotide
313761639 (Method 3) see NCBI Nucleotide
313761640 (Method 3) see NCBI Nucleotide
313761641 (Method 3) see NCBI Nucleotide
313761642 (Method 3) see NCBI Nucleotide
313761643 (Method 3) see NCBI Nucleotide
313761644 (Method 3) see NCBI Nucleotide
313761645 (Method 3) see NCBI Nucleotide
313761646 (Method 3) see NCBI Nucleotide
313761647 (Method 3) see NCBI Nucleotide
313761648 (Method 3) see NCBI Nucleotide
313761649 (Method 3) see NCBI Nucleotide
313761650 (Method 3) see NCBI Nucleotide
313761676 (Method 3) see NCBI Nucleotide
313761678 (Method 3) see NCBI Nucleotide
313761681 (Method 3) see NCBI Nucleotide
313761687 (Method 3) see NCBI Nucleotide
313761688 (Method 3) see NCBI Nucleotide
uncultured ectomycorrhizal fungus see NCBI Taxonomy
78191116 (Method 2) see NCBI Nucleotide
199594073 (Method 2) see NCBI Nucleotide
Dikarya see NCBI Taxonomy
Basidiomycota see NCBI Taxonomy
Agaricomycotina see NCBI Taxonomy
Agaricomycetes see NCBI Taxonomy
Agaricomycetes incertae sedis see NCBI Taxonomy
Cantharellales see NCBI Taxonomy
Clavulinaceae see NCBI Taxonomy
Clavulina see NCBI Taxonomy
Clavulina cristata see NCBI Taxonomy
215433632 (Method 2) see NCBI Nucleotide
Clavulina cf. cinerea BIO 10294 see NCBI Taxonomy
215433641 (Method 2) see NCBI Nucleotide
Clavulina cf. cinerea BIO 10304 see NCBI Taxonomy
215433642 (Method 2) see NCBI Nucleotide
Annotation Process: HMM annotation
Start: 51
End: 294

If you use the database please cite.