Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (64 hits, page 2)

Show entries per page   << Previous    Next >>

Lineage of Clavulina: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Cantharellales; Clavulinaceae; Clavulina;
Select All
>215433623 see NCBI Nucleotide Clavulina cf. rugosa O 67776 Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGCCTTTATGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTATTGGGACGGCTGGCCTTAAATGCATTAGCTGATCCTTGTGTGGCACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTCGGGATGGCCAGTCCTCATTTGGGTTGCTTCTAAACTTGGTGTTGCAATCTGTAATGCCACTTTCAGCTTTGA
..........(((((((..((.((((.....)...))).))))).)))).....((.(...(((..((((..(...)))))))).).)).........(.((..(((.((.(((.((.(.((.((...(((((((((((....))).)..))))))))))))))..))...)))...))))).).....((((((.(((....))).)..)))))........................
>215433624 see NCBI Nucleotide Clavulina cf. amethystina O 175524 Method 2 (see details)
GCGAAATTTCTCAAGCTTTGGATGGCTTTGTTGTCTGTCCTCAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGGTTCTAAACCTGGTTTTGCAGATTCTTCAATCTGTGTTCCACTTTTCAGCTTTGA
..........(((((((..(((((((......))).))))..))).)))).....((.(...(((..(((((......)))))))).).))...........(((((....(((((.((.(.((.((...(((((((((((....))).)..))))))))))))))..))...))).))))).......((.(((....))).)).............................................
>215433626 see NCBI Nucleotide Clavulina cf. rugosa H 6002016 Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGCCTTTATGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGGACGGCTGGCCTTAAATGCATTAGCTGATCCTTGTGTGGCACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTCGGGATGGCCAGTCCTCATTTGGGTTGCTTCTAAACTTGGTGTTGCAAGTTATTTCAATCTGTAATGCCACTTTTCAGCTTTGA
..........(((((((.((..((((.....)...))))).))).)))).....((.(...(((((.((...(...)))))))).).))............((((....(((((.((.(.((.((...(((((((((((....))).)..))))))))))))))..).)..))).))))........(((((..(...))))))..............................................
>215433628 see NCBI Nucleotide Clavulina cf. cristata BIO 10088 Method 2 (see details)
ATTAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTTGTGCGGCACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCTCATTTGGGTTGCTTATAGACCTGGTCTTGCAGATTGTTCAATCTGTGGCTCCACTTTTCAGCTTTGACCTCNA
..........(((((.((((..(((.(....)...))).))))).)))).....((.(...(((..(((((.....)))))))).).))............((((....(((((.((.(.((.((...(((((((((((....))).)..))))))))))))))..))...))).))))........((.(((....))).))....................................................
>215433631 see NCBI Nucleotide Clavulina rugosa Method 2 (see details)
GTGAAATTTCTCAAGCTTGGCTGACAATTTTTTTGTCTGTCCTTAGTTTGGTTGTTGGGCTTTGCCGTCTCCTTCATTGGGACGGCTGGCCTCAAAAGCATTAGCTGATCCTTGTGTGGAACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCCCATTTGGGTTGCTTCTAAACCCGGTTTTGCAGATTGTTTTGATCTGTATTTCCAATTTTCAGCTT
..........(((((.(((((.(((((.....))))).).))..))))))).....((.(...(((((((.(......)))))))).).))............((((.(.......(.(((..((((((..(.((((((((....))).)..))))).))).))).))).)).))))........(.(...).).......................................................
>215433632 see NCBI Nucleotide Clavulina cristata Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGTTTCACAGATTGTRCAATCTGTGTTCCACATTCAGCTTGACCTCGA
(((((..((((((((.(((((((((..(...))))))..).))).))))).....))).))))).(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))..................
>215433636 see NCBI Nucleotide Clavulina rugosa Method 2 (see details)
GTGAAATTTCTCAAGCTTGGCTGACAATTTTTTTGTCTGTCCTTAGTTTGGTTGTTGGGCTTCGCCGTCTCCTTCATTGGGACGGCNGGCCTCAAAAGCATTAGCTGATCCTTGTGTGGAACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCCCATTNGGGTTGCTTCTAAACCCGGTTNCGCAGATTGTTTTGATCTGTATTTCCAATTTTCAGCTTTGA
..........(((((.(((((.(((((.....))))).).))..))))))).....((.(..((((((((.(......)))))))))).))............((((.(.....(.(((((.((..(((..(.((((((((....))).)..))))).)))))).))).))).)))).....(((....)))............................................................
>215433641 see NCBI Nucleotide Clavulina cf. cinerea BIO 10294 Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCCAAACTTGGTTTTGCAGATTCTTCAATCTGTGTTCCACTTTCAGCTTGACCTCGA
(((((..((((((.(((.((((((...(...).))))).).))).)..)..)..))).))))).(((((...(((.(((.((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))..................
>215433642 see NCBI Nucleotide Clavulina cf. cinerea BIO 10304 Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAAYAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCCAAACCTGTGTTTTGCAGAATCTTCAATCTGTGTTCCACTTTTCAGCTTGACCTCGA
(((((..((((((.(((.((((((...(...).))))).).))).)..)..)..))).))))).(((((...(((.(((.((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))...........(...(((((.((.....)))))))..).....................
>215433643 see NCBI Nucleotide Clavulina cristata Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGTTTCACAGATTGTGCAATCTGTGTTCCACATTTCAGCTTGACCTCGA
..........(((((((..((.(((.((...)...)))).)))).))))).(.(.((.(...((((((((.......)))))))).).))..).)......(((((....(((((.((.(.((.((...(((((((((((....))).)..))))))))))))))..))...))).))))).......((.(((...).)).))..................................................
>215433637 see NCBI Nucleotide Clavulina cf. cinerea BIO 10295 Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCCAAACTTGGTTTTGCAGATTCTTCAATCTGTGTTCCACTTTTCAGCTTTGA
..........(((((((.((..((((.....)...))))).))).)))).....((.(...(((((.((...(...)))))))).).))...........(((((....(((((.((.(.((.((...(((((((((((....))).)..))))))))))))))..).)..))).))))).......(((((..(...))))))............................................
>215433638 see NCBI Nucleotide Clavulina cf. cinerea BIO 12533 Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCCAAACTTGGTTTTGCAGATTCTTCAATCTGTGTTCCACTTTTCAGCTTTGA
..........(((((((.((..((((.....)...))))).))).)))).....((.(...(((((.((...(...)))))))).).))...........(((((....(((((.((.(.((.((...(((((((((((....))).)..))))))))))))))..).)..))).))))).......(((((..(...))))))............................................
>215433622 see NCBI Nucleotide Clavulina cristata Method 2 (see details)
GYGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCCCATTTGGGTTGCTTCTAAACCCGGTTTTGCAGATTGTTTTGATCTGTATTCCAATTTCAGCTTGACCTCGA
(((((..((((((((.(((((((((..(...)))))).).))).))))).....))).))))).(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.(((......(.(((.(((((.((((....)))).)).))).))))...))))))))).))).........((...((((((.(.(...))))))))..))...................
>215433625 see NCBI Nucleotide Clavulina cinerea Method 2 (see details)
ACGAAATTTGTCAAGCTTGGATGGCTTTTTTGTCTATCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGGAACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCTCATTTGGGTTGCTTCTAAACTTGGTTTTGCAGATTCTTCAATCTGTGTTCCACTTTTCAGCTTTGA
.((((..((((((((.((((((((...(...).)))).).))).)))))).....)).))))..(((((...(((.(((.(((((((((..(...)))..)))))).)))).))).))))).(((...((((((.((((.....(.(((.(((((.((((....)))).)).))).))))..)))))))))).)))........(((...((((((.(.....)))))))..)))..............
>215433627 see NCBI Nucleotide Clavulina rugosa Method 2 (see details)
GWGAAATTTCYCAAGCTTGGCTGACAATTTTTTTGTCTGTCCTTAGTTTGGTTGTTGGGCTTTGCCGTCTCCTTCATTGGGACGGCTGGCCTCAAAAGCATTAGCTGATCCTTGTGTGGAACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCCCATTTGGGTTGCTTCTAAACCCGGTTTTGCAGATTGTTTTGATCTGTATTCCAATTTCAGCTTTGACCTCGA
..(((..((((((((((.((.((...(...(...)).)).).).))))))).....))).)))...((.((...(((.(((.((((((((.(...).))..)))))).)))..))).)).)).(((...((((((.(((......(.(((.(((((.((((....)))).)).))).))))...))))))))).))).........((...((((((.(.(...))))))))..))....................
>215433629 see NCBI Nucleotide Clavulina rugosa Method 2 (see details)
GTGAAATTTCTCAAGCTTGGATGGCATTTTTGTCTGTCCTTAGTTTGGTTGTTGGGCTTTGCCGTGTCCCTTCACTTGGGACGGCTGGCCTTAAAAACATTAGCTGATCCTCGTGTGGAACTGGTTCTACTCACCGTGATAACAGTCTGATCGCTGAGGACATCTTTTCGGGGATGGCCAGTCCCCATTTGGGTTGCTTCTAAACCTGGTTTTTGCAGATTGTTTYGGTCTGCATTCCAATTTTCAGCTTTGA
.((((..((((((((((.((((((.(.(...))))))).).))))))).....))).))))..((.(((...((.(.(((.(((((((..((...)))..)))))).)))..))).))))).(((...(((((..(((......(.(((.((((((((((....)))))..)).))).))))...))).))))).))).........((....((((((.(.(...))))))))..))...............
>215433630 see NCBI Nucleotide Clavulina cf. cinerea BIO 10296 Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGNCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAAGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCCAAACTTGGTTTTGCAGATTCTTCAATCTGTGTTCCACTTTTCAGCTTTGA
(((((..((((((((.((((((((...(...).)))).).))).))))).....))).))))).(((((...(((.((.((((((((..((...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))..............
>215433633 see NCBI Nucleotide Clavulina rugosa Method 2 (see details)
GTGAAATTTCTCAAGCTTGGCTGACAATTTTTTTTGTCTGTCCTTAGTTTGGTTGTTGGGCTTTGCCGTCTCCTTCATTGGGACGGCTGGCCTCAAAAGCATTAACTGATCCTTGTGTGGAACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCGGTCCCCATTTGGGTTGCTTCTAAACCCAGTTTTGAAGATTGTTTTGATCTGTATTTCCAATTTTCAGCTTTGA
..........(((((((.((..(((((..(.....)).)))))).))))))).....((.(...(((((.((...(...)))))))).).))............((((....(((((.((.(.((.((...(((((((((((....))).)..))))))))))))))..).)..))).))))........(((((..(...))))))..............................................
>215433634 see NCBI Nucleotide Clavulina rugosa Method 2 (see details)
GTGAAATTTCTCAANCTTGGCTGACAATTTTTTTTGTCTGTCCTTAGTTTGGTTTGTTGGGCTTTGCCGTCTCCTTCATTGGGACGGCTGGCCTCAAAAGCATTAGCTGATCCTTGTGTGGAACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCCCATTTGGGTTGCTTCTAAACCCGGTTTTGCAGATTGTRTTGATCTGTATTTCCAATTTTCAGCTTGACCTCGA
(((((..((((((((((.((.((...(....(...)).)).).).))))))....)..))).))))).((.((...(((.(((.((((((((.(...).))..)))))).)))..))).)).)).(((...((((((.(((......(.(((.(((((.((((....)))).)).))).))))...))))))))).))).........((...((((((.(.(...))))))))...))....................
>215433635 see NCBI Nucleotide Clavulina cristata Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCCTAACCTTGGTTGTTGGGCTTTGCCGTGTGCCTTCATTGGAACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGGCAACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCTAAACTTGGTTTGCAGATTCTTCAATCTGTGTTCCACTTTCAGCTTTGA
(((((..((((((((.(((((((((..(...))))))..)))).))))).....))).))))).((.(((...(((.((.(((((((((..(...)))..)))))).)))..)))))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((..((((((.(.....)))))))..))).............
>215433639 see NCBI Nucleotide Clavulina cristata Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGYTGAGGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGTTTCACAGATTGTACAATCTGTGTTCCACATTTCAGCTTTGA
(((((..((((((((.(((((((((..(...)))))).).))).))))).....))).))))).(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))..............
>215433640 see NCBI Nucleotide Clavulina rugosa Method 2 (see details)
GTGAAATTTCTCAAGCTTGGATGGCATTTTTGTCTGTCCTTAGTTTGGTTGTTGGGCTTTGCCGTGTCCCTTCACTTGGGACGGCTGGCCTTAAAAACATTAGCTGATCCTCGTGTGGAACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTCGGGGATGGCCAGTCCCCATTTGGGTTGCTTCTAAACCTGGTTTTTGCAGATTGTTTCGGTCTGCATTCCAATTTTCAGCTTTGA
.((((..((((((((((.((((((.(.(...))))))).).))))))).....))).))))..((.(((...((.(.(((.(((((((..((...)))..)))))).)))..))).))))).(((...((((((.(((......(.(((.((((((((((....)))))..)).))).))))...))))))))).))).........((....((((((.(.(...))))))))..))...............
>215433644 see NCBI Nucleotide Clavulina cristata Method 2 (see details)
GCGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGCTTCACAGATTGTACAATCTGTGTTCCACATTTCAGCTTGACCTGAG
(((((..((((((((.(((((((((..(...)))))).).))).))))).....))).))))).(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))...................
>260161892 see NCBI Nucleotide Clavulina cf. cristata SY-2008 Method 2 (see details)
ACGAAATTTCTCAAGCTTGGATAGTTCATCCATTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTATAGGGATGGCTGGCCTTAAAAGCATTAGCTGATCCTTGTGTGGCACTGGTTCTACTCAGCGTGATAATTGACCTGATCGCTGAGGACATCCTTTCTTTGTGATGGCCGGTCATCATTTGGGTTGCTTCTAAATCTGGTTTTGCAGGTTCTTGAATTTGCATTCCGCTTTTTTCAGCTTTGA
.((((..((((((((.(((.((.(.....).))))).))))).....))).))))..(((((...(((((((.((((((((..(...)))..)))))).)))).))).))))).(((...((((((.((((....((..(((.((((.(((((.(...))..))).)).))).)))).))))))))))).))).........((...((((((.(.....)))))))..)).................
>215433645 see NCBI Nucleotide Clavulina rugosa Method 3 (see details)
GTGAAATTTCTCAAGCTTGGCTGACAATTTTTTTKKYTKGCCTAAKTTGGTTGGTGGGCTTTGCCSTTTCCTTCMTTGGGAMSGYKGGCCTTMAAAACAWWRSYCTGATCCTTGTGTGGAACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCCCATTTGGGTTGCTTCTAAACCCGGTTTTGCAGATTGTTTTGATCTGTATTTCC
(((((..(((((((..(.(......................).)..)))).....))).)))))..((((...(.(.((.(..(.......(....).......)...)))..).).))))..(((...((((((.(((......(.(((.(((((.((((....)))).)).))).))))...))))))))).))).........((...((((((.(......)))))))...))
Select All

Show entries per page   << Previous    Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.