Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (7340 hits, page 2)

Show entries per page   << Previous    Next >>

Lineage of Eumetazoa: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Metazoa; Eumetazoa;
Select All
>722302 see NCBI Nucleotide Culex pipiens Method 1 (see details)
TATATTTATCTATTCAACTGTGCACGCAGTGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGACGCTCAGCGGCTCGGGGTTTTCGTTCGGCGGACGGCCACACTGGTGCGCACGCACGCGACTGAACGGACGACGACGACGGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGCCGATGTAGCATCTCTCACGCCACGTCGTCGTCACACGTTCGTTCGGTCATCCGGCGTCGTCGCGGTACCGCGTCCACAGAACAGAACAACTCAACACACGAGCAGCGATCGACAAGCGATAAGATAAACCCCCCATGTA
.........((((((...(((((((...)))))))..))))))((((((((((((......))).))))))))).............((.(((((((((((((((((...(((((.......(((((((((((.((((((((((((((((((((((((((((((((.((((((.......((((......)))).....)))))).....))))))....))))))))))....)))))))))))).....))))))).)).)))))))))))...)))).))).)))))......))))).)).((((.....))))...................
>722303 see NCBI Nucleotide Culex pipiens Method 1 (see details)
TATATTTATCTATTCAACTGTGCACGCAGTGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGACGCTCAGCGGCTCGGGGTTTTCGTTCGGCGGACGGCCACACTGGTGCGCACGCACGCGACTGAACGGACGACGACGACGGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGCCGATGTAGCATCTCTCACGCACGTCGTCACACGTTCGTTCGGTCATCCGGCGTCGTCGCGGTACCGCGTCCACAGAACAGAACAACCCAACACACGAGCATGCGATCGATAGCGATAAGATAAACCCCCCCATGTA
.........((((((...(((((((...)))))))..))))))((((((((((((......))).))))))))).............((((((((((((((((((((...(((((.......(((((((((((.(((((((((((((((((..(((((((((((((.((((((.......((((......)))).....)))))).....))))))...)))))))...))))))))))))).....))))))).)).)))))))))))...)))).))).)))))......))))).))).((((....))))....................
>722298 see NCBI Nucleotide Culex pipiens Method 1 (see details)
TATATTTATCTATTCAACTGTGCGCACACACGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGACGCTCAGCGGCTCGGGGTTTTCGTTCGGCGGACGGCCACACCGGTGCGCACGCACGCGACTGAACGGACGACGACGACGGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGCCGATGTAGCATCTCTCACGCCACGTCGTCGTCACACGTTCGTTCGGTCATCCGGCGTCGTCGCGGTACCGCGTCCACAGAACAGAACAACCCAACACACGAGCAGCGATCGACAAGCGATAAGATAAACCCCCCATGTA
.........((((((...((((((......))))))..))))))((((((((((((......))).))))))))).............((.(((((((((((((((((...(((((.(...((((..(((.((((.((.((((((((((((((((((((((((((((.((((((.......((((......)))).....)))))).....))))))....))))))))))....))))))))))))...)))))))))..))))...))))))...)))).))).)))))......))))).)).((((.....))))...................
>722299 see NCBI Nucleotide Culex pipiens Method 1 (see details)
TATATTTATCTATTCAACTGTGCGCACACACGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGACGCTCAGCGGCTCGGGGTTTTCGTTCGGCGGACGGCCACACTGGTGCGCACGCACGCGACTGAACGGACGACGACGACGGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGCCGATGTAGCATCTCTCACGCCACGTCGTCGTCACACGTTCGTTCGGTCATCCGGCGTCGTCGCGGTACCGCGTCCACAGAACAGAACAACCCAACACGCGAGCAGCGATCGACAAGCGATAAGATAAACCCCCCATGTA
.........((((((...((((((......))))))..))))))((((((((((((......))).)))))))))........((((.(((.....((((((((((((...(((((.......(((((((((((.((((((((((((((((((((((((((((((((.((((((.......((((......)))).....)))))).....))))))....))))))))))....)))))))))))).....))))))).)).)))))))))))...)))).))).)))))....)))))))....((((.....))))...................
>722301 see NCBI Nucleotide Culex pipiens Method 1 (see details)
TATATTTATCTATTCAACTGTGCACGCAGTGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGACGCTCAGCGGCTCGGGGTTTTCGTTCGGCGGACGGCCACACTGGTGCGCACGCACGCGACTGAACGGACGACGACGACGGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGCCGATGTAGCATCTCTCACGCACGTCGTCGTCACACGTTCGTTCGGTCATCCGGCGTCGTCGCGGTACCGCGTCCACAGAACAGAACAACCCAACACACGAGCATGCGGTCGATAGCGATAAGATAAACCCCCCCATGTA
.........((((((...(((((((...)))))))..))))))((((((((((((......))).))))))))).............((((((((((((((((((((...(((((.......(((((((((((.((((((((((((((((((((((((((((((((.((((((.......((((......)))).....)))))).....))))))...))))))))))....)))))))))))).....))))))).)).)))))))))))...)))).))).)))))......))))).))).((((....))))....................
>722305 see NCBI Nucleotide Culex pipiens Method 2 (see details)
TATATTTGTCTATTCAACTGTGCGCACACACGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGACGCTCAGCGGCTCGGGGTTTTCGTTCGGCGGACGGCCACACTGGTGCGCACGCACGCGACTGAACGGACGACGACGACGGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGCCGATGTAGCATCTCTCACGCCACGTCGTCGTCACACGTTCTTTCGGTCATCCGGCGTCGTCGCGGTACCGCGTCCACAGAACAGAACAACCCAACACACGAGCTTGCGATCGATAGCGATAAGAAGATAAACCCCCCATGTA
.........((((((...((((((......))))))..))))))(((((((((((((...).))).))))))))).............((((((((((((((((((((.(.(((((.......(((((((((((.(((((((((((.(((((((((((((((((((((((((((((.((.((((...))).)))))....))))))...).))))))....))))))))))....)))).))))))).....))))))).)).))))))))))).).)))).))).)))))......))))).))).((((....))))......................
>722306 see NCBI Nucleotide Culex restuans Method 2 (see details)
TATATTTATCTATTCAACTGTGTCGGCACCACCTCGACTGGTGCCGGCACGCAGAACGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGATACTCCCGGTTCGGGCGGTTGCGGCGACCAGCTAACACTGGTGCGCGACACACACGACGCGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGACGATGTAACCTCTCACACTCCTGCGTTGACGTGTCGCGGTACCGGGTCGTTCTCGCAACCGACCGTGCACACACCGCATAGATAAACCCCCATGTA
.........((.(((...(((((((((((...(......))))))))))))..))).))(((((((((((((...).))).)))))))))...............(((((((((((((((((((((.........(((((((((((((.((..(((.(((.(((((((((...(.(.(((((...).))))).)..))))))...).)).)))..).)..)))..))))))).))))))))))))..).))))))).)).)).).))..........((.(......).))
>722307 see NCBI Nucleotide Culex restuans Method 2 (see details)
TATATTTATCTATTCAACTGTGTCGGCACCACCTCGACTGGTGCCGGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGATACTCCCGGTTCGGGCGGTTGCGGCGACCAGCTAACACTGGTGCGCGACACACACGACGCGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGACGATGTAAACTCTCACACTCCTGCGTTGAGGTGTCGCGGTACCGGGTCGTTCTCGCAACCGACCGTGCACACACCGCATAGATAAACCCCCATGTA
.........((((((...(((((((((((...(......))))))))))))..))))))(((((((((((((...).))).)))))))))...............(((((((((((((((((((((.........(((((((((((((.((..(((.(((.(((((((((...(.(.(((((...).))))).)..))))))...).)).)))..).)..))).).)))))).))))))))))))..).))))))).)).)).).))..........((.(......).))
>722308 see NCBI Nucleotide Culex restuans Method 2 (see details)
TATATTTATCTATTCAACTGTGTCGGCACCACCTCGACTGGTGCCGGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGATACTCCGGTTCGGGCGGTTGCGGCGACCAGCTAACACTGGTGCGCGACACACACGACGCGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGACGATGTAACCTCTCACACTCCTGCGTTGACGTGTCGCGGTACCGGGTCGTTCTCGCAACCAACCGCAACATGTAGATAAACCCCCATGTA
.........((((((...(((((((((((...(......))))))))))))..))))))(((((((((((((...).))).)))))))))................(.(..((((((((((((((.........(((((((((((((.((..(((.(((.(((((((((...(.(.(((((...).))))).)..))))))...).)).)))..).)..)))..))))))).))))))))))))..).))))))....)).)........((.(......).))
>722309 see NCBI Nucleotide Culex restuans Method 2 (see details)
TATATTTATCTATTCAACTGTGTCGGCACCACTCGCCTGGTGCCGGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGATACTCCCGGTTCGGGCGGTTGCGGCGACCAGCTAACACTGGTGCGCGACACACACGACGCGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGACGATGTAACCTCTCACACTCCTGCGTTGACGTGTCGCGGTACCGGGTCGTTCTCGCAACCAACCGCAACATGTAGATAAACCCCCATGTA
.........((((((...(((((((((((....(....))))))))))))..))))))(((((((((((((...).))).))))))))).................(.(..((((((((((((((.........(((((((((((((.((..(((.(((.(((((((((...(.(.(((((...).))))).)..))))))...).)).)))..).)..)))..))))))).))))))))))))..).))))))....)).)........((.(......).))
>722310 see NCBI Nucleotide Culex restuans Method 2 (see details)
TATATTTATCTATTCAACTGTGTCGGCACCACTCGCCTGGTGCCGGCACGCAGAATGGTGTTTTGCTGCCCTTCGGTGGCTGGCAAAACATTCAAGATACTCCCGGTTCGGGCGGTTGCGGCGACCAGCTAACACTGGTGCGCGACACACACGACGCGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGACGATGTAACCTCTCACACTCCTGCGTTGACGTGTCGCGGTACCGGGTCGTTCTCGCAACCAACCGTGCACACACCGCATAGATAAACCCCCATGTA
.........((((((...(((((((((((....(....))))))))))))..))))))((((((((((.(((...).))).)))))))))...............(((((..((((((((((((((.........(((((((((((((.((..(((.(((.(((((((((...(.(.(((((...).))))).)..))))))...).)).)))..).)..)))..))))))).))))))))))))..).))))))....))).).))..........((.(......).))
>722311 see NCBI Nucleotide Culex restuans Method 2 (see details)
TATATTTATCTATTCAACTGTGTCGGCACCACCTCGACTGGTGCCGGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGATACTCCCGGTTCGGGCGGTTGCGGCGACCAGCTAACACTGGTGCGCGACACACACGACGCGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGACGATGTAACCTCTCACACTCCTGCGTTGACGTGTCGCGGTACCGGGTCGTTCTCGCAACCAACCGTGCACACACCGCATAGATAAACCCCCATGTA
.........((((((...(((((((((((...(......))))))))))))..))))))(((((((((((((...).))).)))))))))...............(((((..((((((((((((((.........(((((((((((((.((..(((.(((.(((((((((...(.(.(((((...).))))).)..))))))...).)).)))..).)..)))..))))))).))))))))))))..).))))))....))).).))..........((.(......).))
>722312 see NCBI Nucleotide Culex salinarius Method 2 (see details)
TATATTTATCTATTCAACTGTGCGTGTGCACCCCTCTCGCGGGGGGTATGCACGCACGCAGCATGGTGCTTTGCTGCGCTTTAGGTGCGCTGGCAAAACATTCAAGACACTCCGGTTCGGGGTTGCAGCGACCACTGAAACACTGGTGCGCGACACACGAACGTGAGAATACATACCACTGCTCCAACCTGGCTTGGGCGCCGATGTAAGCTCTCTCGCGTTGCTACGTGCTGTCGCGGTACGCGGTCGCTAGAAGCAGCCGACACCGACACCGACACTAGATAGACACCCCATGTA
.........((((.(...(((((..(((((.((((((...))))))..))))))))))..).))))((.(((((((.((((...).).))))))))).))............(((((((((((((((((((((...........((((((((((((((((((((((((((((((....((((.(((((...).)))))))..))))))...).)))))))))....)))).)))))).)))).))))))))....))))))....)))).))))........((.(.......).))
>722313 see NCBI Nucleotide Culex salinarius Method 2 (see details)
TATATTTATCTATTCAACTGTGCGTGTGCACCCCTCTCGCGGGGGGTATGCACGCACGCAGCATGGTGCTTTGCTGCGCTTTAGGTGCGCTGGCAAAACATTCAAGACACTCCGGTTCGGGGTTGCAGCGACCACTGAAACACTGGTGCGCGACACACGAATGTGAGAATACATACCACTGCTCCAACCTGGCTTGGGCGCCGATGTAAGCTCTCTCGCGTTGCTACGTGCTGTCGCGGTACGCGGTCGCTAGAAGCAGCCGACACCGACACCGACACTAGATAGACACCCCATGTA
.........((((.(...(((((..(((((.((((((...))))))..))))))))))..).))))((.(((((((.((((...).).))))))))).))............(((((((((((((((((((((...........((((((((((((((((((((((((((((((....((((.(((((...).)))))))..))))))...).)))))))))....)))).)))))).)))).))))))))....))))))....)))).))))........((.(.......).))
>722314 see NCBI Nucleotide Culex salinarius Method 2 (see details)
TATATTTATCTATTCAACTGTGCGTGTGCACCCCTCTCGCGGGGGGTATGCACGCACGCAGCATGGTGCTTTGCTGCGCGTAGGTGCGCTGGCAAAACATTCAAGACACTCCCGGTTCGGGGTTGCAGCGACCACTGAAACACTGGTGCGCGACACACGAACGTGAGAATACATACCACTGCTCCAACCTGGCTTGGGCGCCGATGTAAGCTCTCTCGCGTTGCTACGTGCTGTCGCGGTACCGCGGTCGCTAGAGGCAGCCGACACCGACACCGACACTAGATAGACACCCCATGTA
.........((((.(...(((((..(((((.((((((...))))))..))))))))))..).))))((.(((((((((((....))))).)))))).)).............(((((((((((((((((((((...(......(((((((((((((((((((((((((((((((....((((.(((((...).)))))))..))))))...).)))))))))....)))).)))))).))))))))))))))....))))))....)))).))))........((.(.......).))
>722315 see NCBI Nucleotide Culex salinarius Method 2 (see details)
TATATTTATCTATTCAACTGTGCGTGTGCACCCCTCTCGCGGGGGGTATGCACGCACGCAGCATGGTGCTTTGCTGCGCTTAGGTGCGCTGGCAAAACATTCAAGACACTCCCGGTTCGGGGTTGCAGCGACCACTGAAACACTGGTGCGCGACACACGAACGTGAGAATACATACCACTGCTCCAACCTGGCTTGGGCGCCGATGTAAGCTCTCTCGCGTTGCTACGTGCTGTCGCGGTACCGCGGTCGCTAGAAGCAGCCGACACCGACACCGACACTAGATAGACACCCCATGTA
.........((((.(...(((((..(((((.((((((...))))))..))))))))))..).))))((.(((((((((((...).)))).)))))).)).............(((((((((((((((((((((...(......(((((((((((((((((((((((((((((((....((((.(((((...).)))))))..))))))...).)))))))))....)))).)))))).))))))))))))))....))))))....)))).))))........((.(.......).))
>722316 see NCBI Nucleotide Culex salinarius Method 2 (see details)
TATATTTATCTATTCAACTGTGCGTGTGCACCCCTCTCGCGGGGGGTATGCACGCACGCAGCATGGTGCTTTGCTGCGCTTAGGTGCGCTGGCAAAACATTCAAGACACTCCCGGTTCGGGGTTGCAGCGACCACTGAAACACTGGTGCGCGACACACGAACGTGAGAATACATACCACTGCTCCAACCTGGCTTGGGCGCCGATGTAAGCTCTCTCGCGTTGCTACGTCGCTGTCGCGGTACCGCGGTCGCTAGAAGCAGCCGACACCGACACCGACACTAGATAGACACCCCATGTA
.........((((.(...(((((..(((((.((((((...))))))..))))))))))..).))))((.(((((((((((...).)))).)))))).)).............(((((((((((((((((((((...(......(((((((((((((((((((((((((((((((....((((.(((((...).)))))))..))))))...).)))))))))....))).).)))))).))))))))))))))....))))))....)))).))))........((.(.......).))
>722317 see NCBI Nucleotide Culex salinarius Method 2 (see details)
TATATTTATCTATTCAACTGTGCGTGTGCACCCCTCTCGCGGGGGGTATGCACGCACGCAGCATGGTGCTTTGCTGCGCTTAGGTGCGCTGGCAAAACATTCAAGACACTCCCGGTTCGGGGTTGCAGCGACCACTGAAACACTGGTGCGCGACACACGAACGTGAGAATACATACCACTGCTCCAACCTGGCTTGGGCGCCGATGTAAGCTCTCTCGCGTTGCTACGTCGCTGTCGCGGTACCGCGGTCGCTAGAAGCAGCCGACACCGACACCGACACTAGATAGACACCCCATGTA
.........((((.(...(((((..(((((.((((((...))))))..))))))))))..).))))((.(((((((((((...).)))).)))))).)).............(((((((((((((((((((((...(......(((((((((((((((((((((((((((((((....((((.(((((...).)))))))..))))))...).)))))))))....))).).)))))).))))))))))))))....))))))....)))).))))........((.(.......).))
>722300 see NCBI Nucleotide Culex pipiens Method 3 (see details)
CTATTCAACTGTGCGTGTACACACACGCACGCAGAATGGTGTTTGGCTGGCAAAACATTCAAGACGCTCAGCGGCTCGGGGTTTTCGTTCGCGGACGGCCACACTGGTGCGCACGCACGCGACTGAACGGACGACGACGGTGAGAATACATCCCACACACCAACCCGGCTTGGGCGCCGATGTAGCATCTCTCACGCACGTCGTCGTCACACGTTCGTTCGGTCATCCGGCGTCGTCGCGGTACCGCGTCCACAGAACAGAACAACCCAACACACGAGCATGCGATCGATAGCGATAAGATAAACCCCCCCATGT
((((((...(((((((........)))))))..))))))((((..........)))).......((((.((((((((((((((((((((((.(((((.......(((((((((((.((((((((((((((((((((((((((((((((((((...(.(.(((((...).))))).)..))))))...).))))))...)))))))))).)......)))))))).....))))))).)).))))))))))).).)))).))).)))))......))))).)))..)....)))).....(((..........)))
>984840 see NCBI Nucleotide Anopheles quadrimaculatus B Method 3 (see details)
TTGACACAAGTCAAACTACGTCGGCGGGGCCAGCCCCACGCCGTGCGTGCATCATGATGAAAGAGTGTGGGACGCGAACGCGCACCACCTCTTGCATTGAAAGGCGTAGCGTGCTTCCCTAGGGCTCAACTTGCAAAGTGGCCATGGGGCCGACACCTCACCACCATCTAAAGCGTGTTGTGTAGTGTGTTCGGCCCGTTTCGGTCATCGTGAGGCGAGCCCAACGTGGGACAGCACTCTGGCTACAAGTCCGGC
(((...).))..................................(((....(..(((((.(((.....((..............))....))).)))))......)...)))....(((..(....(..(((((...((((((..((((((((((((((((((((.......).)))..))).)).))))).)).))..)).)))))).)).))).).........))))...((......(...).......))
>837019 see NCBI Nucleotide Schistosoma mansoni Method 3 (see details)
TCACGACGCACATTAAGTCGTGGATTGGGCGAGTGCCTGCCGGCGTTTAAACCCGCATATCAACGCGGGTTGCTGGTCAGAGGCTCCGTCCTAATAATCCGGCCACAGCCTAGTCTGGTCTAGATGACTTGATTGAGATGCTGCGGTGGGTTGTGCTCGAGTCGTGGCTTAATGACATTATACACGCTCGGGATAATTCGCACCTATCGTATGCTACGTTAATCACTTGATCTTGTCTCTGGTTTGGTCTATGGTTTGTACCGATTGTGTGTGTATTATGCACGA
(((((((..(...)..)))))))...(((((.(.(((((((((((.....((((((.(...)..)))))))))))))...))))).)))))........(((..(((((((((.((((.(((((.(((..(((((((((((((((((((((((((((((((.((((..(((((...)))).))))))))))).).))..).)))))))))).)).)..)......)))))))..)))))))).)))).))).)).)))).))).(((((((((...)))))))))
>837017 see NCBI Nucleotide Schistosoma intercalatum Method 3 (see details)
TCACGGCGCACATTGAGTCGTGGATTGGGCGAGTGCGTGCCGGCGTGTATACCCGCATATCAACGCGGGTTGCTGGTCAAAGGCTCCGTCCTAATAGTCCGGCCACAGCCTAGTCCGGTCTAGATGACTTGATTGAGATGCTGCGGTGGGTTGTGCTCGAGTCGTGGCTTAATGACATTATACACGCTCGGGAAGAATCGCACCTATCGTACGCTACGTTGGTCACTTGATCTTGTCTCTATGGTTCGGTCTATGGTTTGTACCGATGGTGTGTGTAATACGCACGA
(((((((.((...)).)))))))...(((((.(.((.((((((((.....((((((.(...)..)))))))))))))...).))).)))))........(((..(((((((((.((((.(((((.(((..((((((((((((((((((((((((.((((((.((((..(((((...)))).)))))))))))...).).).)))))))))).)).)..)......)))))))..)))))..))).)))).))).)).)))).))).(.(((((((...))))))).)
>837016 see NCBI Nucleotide Schistosoma haematobium Method 3 (see details)
TCACGGCGCACATTGAGTCGTGGATTGGGCGAGTGCGTGCCGGCGTGTATACCCGCATATCAACGCGGGTTGCTGGTCGAAGGCTCCGTCCTAATAGTCCGGCCACAGCCTAGTCCGGTCTAGATGACTTGATCGAGATGCTGCGGTGGGTTGTGCTCGAGTCGTGGCTTAATGACATTATACGCGCTCGGGAAGAATCGCACCTATCGTACGCTACGTTGGTCACTTGATCTTGTCTCTATGGTTCGGTCTACGGTTTGTACCGATGGTGTGTGTAATACGCACGA
(((((((.((...)).)))))))...(((((.(.((.((((((((.....((((((.(...)..)))))))))))))...).))).)))))........(((..(((((((((.((((.(((((.(((..((((((((((((((((((((((((.((((((.((((..(((((...)))).)))))))))))...).).).)))))))))).)).)..)......)))))))..)))))..))).)))).))).)).)))).))).(.(((((((...))))))).)
>837015 see NCBI Nucleotide Schistosomatium douthitti Method 3 (see details)
TCATTTATCACGACGCACATTTAGTCGTGGATTGGGTGTGTGCCTGCCAGCGTGCTTACCTGCATATCAACGTGGGTTGCTGGTCTAAGGCTCCATCCTAATTTCTCCGGCCACAGCCTAGTCCGGTGTAGAAGACCAGATTGAGTTGCTGCGGTGGGTTGTGCTCGAGTCGTGGCTTAATGAAATAAATATATATATACATATAAATAATGTACACGCTCGGGAGAACATGGCCTATTGCACAAATATACAAATATGTAAGCATATTTAAAAAAAGCTTAATCTTGGTTCTGCNAAGCGGATTGATGGTTTGTACCGAGGGTGTGTAACACACATAACC
((.(((...).)).).)..........((((.((((((.(.((((((((((......((((((.(...)..)))))).))))))...))))).))))).).....))))....((((((.(.(....(((((..((.((((((((((..((((((((((((((((((((.((((..(((((((.((......)).).))..).))........)))))))))))....)))))))))))))).................................)))))))))).).)))))).....)...).).)).)))....(...((((((...))))))...)
>722304 see NCBI Nucleotide Culex pipiens Method 3 (see details)
CTATTCAACTGTGCGCACACACGCACGCAGAATGGTGTTTTGCTGCCTTCGGTGGCTGGCAAAACATTCAAGACGCTCAGCGGCTCGGGGTTTTCGTTCGGCGGACGGCCACACTGGTGCGCACGCACGCGACTGAACGGACGACGACGACGGTGAGAATACATCCCACACACCAACCTGGCTTGGGCGCCGATGTAGCATCTCTCACGCACGTCTCGTCACACGTTCGTTCGGTCATCCGGCGTCGTCGCGGTACCGCGTCCACAGAACAGAACAACCCAACACACGAGCATGCGATCGATAGCGATAAGATAAACCCCATGT
((((((...((((((......))))))..))))))(((((((((((((...).))).))))))))).......((((.(((((((((((((((((((((.(.(((((.......(((((((((((.(((((((((((((...(((((.(((((((((((((((((...(.(.(((((...).))))).)..))))))...).))))))...))))))))).)......)))))))).....))))))).)).))))))))))).).)))).))).)))))......))))).)))..)....)))).....(((.......)))
Select All

Show entries per page   << Previous    Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.