Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (169006 hits, page 2)

Show entries per page   << Previous    Next >>

Lineage of Fungi/Metazoa group: root; cellular organisms; Eukaryota; Fungi/Metazoa group;
Select All
>64456 see NCBI Nucleotide Xenopus borealis Method 1 (see details)
GCTCCGACGTCCATCGCCCCCGCCGGGTCCCCGACCCGGGGAAAACGGGCGGCGCGGCTGGGGCCGTCGCAGGGGTCGAGGGACGCCCCCCCACCGCCCTTCCGGGGGAGGTGAGGGGGCCCCGCGACCCCTTCGTCCCCCCAAGGCCAGACCCCGACCATCCCGGCGGCCCCCCCCAGGGCCCCGGCGCGGCTGTCTGTGGGAAACCGATTTCACGGCTGCCGGCGCCGCGGGCGCTGGGGACCCGCCGGGGCGGGAAGAGCCCCCGGGCGGGCCGGGGCCGGGGAAGGCGCGCTTGAACCCGCGCCCCCCCGCGTCCCCCGCCCGCCCCCCCGCTCGACTCAGA
.............((((((((.(((((((...))))))))).....))))))...((((((((....((.((((((((.(((..((((((.((((.((((....)))).)))).))))))))).)))))))).))...))))..))))....((((.....((((((((....((((((.(((((((((((((.(.((((((((......))))))))).))).)))))).)))).))))))..)))))))).))))..((((....((((((((.((((((((((..((((((........)))))).))))).).)))).))))))))....))))........
>2714 see NCBI Nucleotide Neotyphodium huerfanum Method 2 (see details)
ATTTCAACCCTCAAGCCCGCTGCGTGCTTGGTGTTGGGGACCGGCCCGCCCGCCTCGNCNGCGGCGNNNNNCCCTGAAATGAATTGGCGGTCTCGTCGCAGCCTCCTTTGCGTAGTAGCACACCACCTCGCAACCGGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTCTCCAAGAGTTGA
..........(((((((.(...)).))))))..((((((((((..(((.((((...)).)))))))))...)))))).......(((((((...(((((.((((((((((((.(((.(....).)).))))))..))))).))...))))).))))))).........((((((......)))))).
>2732 see NCBI Nucleotide Gibberella pulicaris Method 2 (see details)
ATTTCAACCCTCAAGCCCGGCTTGGTGTTGGGAGCTGTCGTCTGACACTCCCCAAATACATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAATCGTCGCGGCCACGCGTTAAACCCAACTTCTGAATGTTGA
...........(((((...)))))((((((((((.((((....)))))))))..)))))..((.(((((.((.(((..((((((((((.((((...)))...)))))).))).))))).)).))))..))).......((((((...)).)))).
>2731 see NCBI Nucleotide Gibberella pulicaris Method 2 (see details)
ATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGAGCTGTTTTAGTTAACACTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAATCGACGCGGCCAACGCGTTAAACCCAACTTCTGAATGTTGA
.....(((..((((((...)))))).)))(((((.((((......)))))))))....((((.((.(((((.((((((..((((((((((.((((...)))...)))))).))).)))))))).))))...)))))))...((((((...)).)))).
>2733 see NCBI Nucleotide Gibberella pulicaris Method 2 (see details)
ATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGAGCTGTTTTAGTTAACACTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAATCGACGCGGCCAACGCGTTAAACCCAACTTCTGAATGTTGA
.....(((..((((((...)))))).)))(((((.((((......)))))))))....((((.((.(((((.((((((..((((((((((.((((...)))...)))))).))).)))))))).))))...)))))))...((((((...)).)))).
>2734 see NCBI Nucleotide Gibberella pulicaris Method 2 (see details)
ATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGCGGCGCCGCCCCCGAAATACATTGGCGGTCTCGCTGCAGCCTCCATTGCGTAGTAGCTAACACCTCGCAACTGGAACGCGGCGCGCCATGCCGTAAAACCCCAACTTCTGAATGTTGA
..........(((((((...)).)))))..((((((..((((.(((((.....))))).)))).)))))).......(((((((..((((((.(..(((((((((.(((.(....))).)))))).)))).))))))).)))..))))........((((((...)).)))).
>2735 see NCBI Nucleotide Gibberella pulicaris Method 2 (see details)
ATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGAGCTGTCGTCTGACACTCCCCAAATACATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAATCGTCGCGGCCACGCGTTAAACCCAACTTCTGAATGTTGA
...........(((((...)))))((((((((((.((((....)))))))))..)))))..((.(((((.((.(((..((((((((((.((((...)))...)))))).))).))))).)).))))..))).......((((((...)).)))).
>2736 see NCBI Nucleotide Gibberella pulicaris Method 2 (see details)
ATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGAGCTGTCGTCTGACACTCCCCAAATACATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAATCGTCGCGGCCACGCGTTAAACCCAACTTCTGAATGTTGA
...........(((((...)))))((((((((((.((((....)))))))))..)))))..((.(((((.((.(((..((((((((((.((((...)))...)))))).))).))))).)).))))..))).......((((((...)).)))).
>2921 see NCBI Nucleotide Lentinula edodes Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATGTTGGAGGCTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGGAACCCTGTTTTGTTAGTTCTAACCTTGGTGTGATAATTATCTACATTTTGGTGGAACCTTACAAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTAGTTTGCTCAATCTGTTCTATTCATTGGAGAAAAAGGGAAGTTCTGCTTTCTAACTGTCTTGATTGACTATATATAACTTATTTGCTTGA
.........((((((.(((((((....)))))).)).).)))).....(((((...((.(((....))).)).)))))...........(((((......((((((((((..........((((((((....))).))))))))))))))))))))........(.(..((...)))).........................................................................................................
>65056 see NCBI Nucleotide Xenopus laevis Method 1 (see details)
GACGTCCATCGCCCCCGCCGGGTCCCGTCCCGGCGCGGAGGCGCGGCTGGGGCCGTCGCAGGGGCGCGCCGCTCCCCTTCGTCCCCCCAAGGCCAGACCCCCGGCCCGGCGCCCGGGCCCCGGCCCGGCCGGCGGCGGCTGTCTGTGGATCCCTTCACGGCTGCCGCCCCGGCCGGCCCCCCGGGGCCCCGGCCCGCCGGCGGGAGCGGGCCCGGCCCCCCCCCCCGGGCCGCGGCCCCGCGCCCCCCCCCCCCCCCACGAC
.........(((((((((((((......))))))).)).)))).((((((((....((.(((((.((...)).))))).))...))))..))))...((((((((..((.(((.(((((((((.((((((((.((((((.(.(((((((....)))))))).))))))))))))))....))))))))).)))))))))).))).(((((((((((((........)))))).)).))))).....................
>3259 see NCBI Nucleotide Schedonorus arundinaceus symbiont ATCC 56207 Method 1 (see details)
ATTATAACCACTCAAGCTCTCGCTTGGTATTGGGGTTCGCGGTCTCGCGGCCCCTAAAATCAGTGGCGGTGCCTGTCGGCTCTACGCGTAGTAATACTCCTCGCGTCTGGGTCCGACAGGTCTACTTGCCAACAACCCCCAATTTTTTACAGGTT
...........((((((....))))))..((((((.(((((....))))).))))))......(((((((((((((((((((.(((((.(((...)))...)))))..))).)))))))))..)).)))))..((((..............))))
>64487 see NCBI Nucleotide Xenopus laevis Method 2 (see details)
GCTCCGACGTCCATCGCCCCCGCCGGGTCCCGTCCCGGCGCGGAGGCGCGGCTGGGGCCGTCGCAGGGGCGCGCCGCTCCCCTTCGTCCCCCCAAGGCCAGACCCCCGGCCCGGCGCCCGGGCCCCGGCCCGGCCGGCGGCGGCTGTCTGTGGATCCCTTCACGGCTGCCGCCCCGGCCGGCCCCCCGGGGCCCCGGCCCGCCGGCGGGAGCGGGCCCGGCCCCCCCCCCCGGGCCGCGGCCCCGCGCCCCCCCCCCCCCCCACGACTCAGA
..............((((((((((((((...).))))))).)).)))).((((((((..(.((.(((((.((...)).))))).)))..))))..))))...((((((((..((.(((.(((((((((.((((((((.((((((.(.(((((((....)))))))).))))))))))))))....))))))))).)))))))))).))).(((((((((((((........)))))).)).)))))..........................
>161032 see NCBI Nucleotide Schistosoma bovis Method 3 (see details)
TCACGGCGCACATTGAGTCGTGGATTGGGCGAGTGCTGCCGGCGTGTATACCCGCATATCAACGCGGGTTGCTGGTCAAAGGCTCCGTCCTAATAGTCGCCACAGCCTAGTCCGGTCTAGATGACTTGATTGAGATGCTGCGGTGGGTTGTGCTCGAGTCGTGGCTTAATGACATTATACACGCTCGGGAAGAATCGCACCTATCGTACGCTACGTTGGTCACTTGATCTTGTCTCTATGGTTCGGTCTATGGTTTGTACCGATGGTGTGTGTAATACGCACGA
(((((((.((...)).)))))))...(((((.(.((((((((((.....((((((.(...)..)))))))))))))...)).)).)))))........(..(((((((((.((((.(((((.(((..((((((((((((((((((((((((.((((((.((((..(((((...)))).)))))))))))...).).).)))))))))).)).)..)......)))))))..)))))..))).)))).))).)).)))).)...(.(((((((...))))))).)
>5074 see NCBI Nucleotide Schizosaccharomyces pombe Method 1 (see details)
ATTACAATCTTCTCACAAAAAATGTTTTTTTTAAATATTTTTGATGAGGTGTTGAACGAAAATTTGTTTTTTTTTTAAAATATAAATTTAGTTTGAAATCGATTGGTGAAAACAAAAGGAAGATTGAAATTATTTTTCTATGCCTTTTTTCATTTTTTTTTCTATTGAACGTAATAGGTTTTACCACTTTGTTTGATAGAAAAAAAGAAATTAGGAAAGAAAAATAACTAAAAAGTTTTAATCTCTTTTATATTTGAACCTTAACGAAAAAAAAAGTTATTTTTTTTTCACAGTACCTTTTTTATTTGA
..........(((((..((((((((((.....))))))))))..)))))..((((((..((((((((...(((....))).)))))))).))))))........(((..(((..((((((.((((((((((((((((((...(((..((((...(((((((((((((((((.....(((...)))....)))))))))))))))))))))..)))..)))))))))........)))))))))))))))...)))..))).....((((((((((....))))))))))....................
>2746 see NCBI Nucleotide Lolium perenne symbiont ATCC 56210 Method 1 (see details)
ATTATAACCACTCAAGCTCTCGCTTGGTATTGGGGTTCGCGGTCTCGCGGCCCCTAAAATCAGTGGCGGTGCCTGTCGGCTCTACGCGTAGTAATACTCCTCGCGTCTGGGTCCGACAGGTCTACTTGCCAACAAAACCCAATTTTTTACAGGTTGA
...........((((((....))))))..((((((.(((((....))))).))))))......(((((((((((((((((((.(((((.(((...)))...)))))..))).)))))))))..)).)))))....((((............))))..
>2741 see NCBI Nucleotide Gaeumannomyces graminis Method 1 (see details)
ATTTCACCACTCAAGCCCAGCTTGGTGTTGGGGCTCCCGGCGCCCGGCGGTCGGGGCCCCCAAGTACATCGGCGGTCTCGCCAGGACCCTGAACGCAGTAACTCGCGGTAAAACGCGACTTCGTTCGGAGGCTTCCCGGCAAACTCCAGCCGCTAAACCCCCTAAACTTCTTAGGTTG
.......(((.(((((...))))))))((((((.(((((((((...)).))))))).)))))).......((((((...(((.((((((((((((.((....(((((......))))))).))))))).))..))).)))........))))))......(((((.....)))))...
>2713 see NCBI Nucleotide Epichloe festucae Method 1 (see details)
ATTTCAACCCTCAAGCCCGCTGCGCGCTTGCTGTTGGGGACCGGCTCACCCGCCTCGCGGCGGCGGCCGCCCCCGAAATGAATCGGCGGTCTCGTCGCAAGCCTCCTTTGCGTAGTAACACACCACCTCGCAACCGGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTTCTCCAAGAGTTGA
...........(((((.((...)).)))))...((((((..(((((...(((((....))))).))))).)))))).......(((((((.(((.(((..((((((((((((..((........))..)))))..))))).)).))))))..))))))).........(((((((.....))))))).
>2716 see NCBI Nucleotide Neotyphodium coenophialum Method 1 (see details)
ATTTCAACCCTCAAGCCCGCTGCGCGCTTGCTGTTGGGGACCGGCTCACCCGCCTCGCGGCGGCGGCCGCCCCCGAAATGAATCGGCGGTCTCGTCGCAAGCCTCCTTTGCGTAGTAGCACACCACCTCGCAACCGGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTTCTCCAAGAGTTGA
...........(((((.((...)).)))))...((((((..(((((...(((((....))))).))))).)))))).......(((((((.(((.(((..((((((((((((..((........))..)))))..))))).)).))))))..))))))).........(((((((.....))))))).
>2682 see NCBI Nucleotide Festuca arizonica symbiont p1572 Method 1 (see details)
ATTATAACCACTCAAGCTCTCGCTTGGTATTGGGGTTCGCGGTCTCGCGGCCCCTAAAATCAGTGGCGGTGCCTGTCGGCTCTACGCGTAGTAATACTCCTCGCGTCTGGGTCCGACAGGTCTACTTGCCAACAAAACCCAATTTTTTACAGGTTGA
...........((((((....))))))..((((((.(((((....))))).))))))......(((((((((((((((((((.(((((.(((...)))...)))))..))).)))))))))..)).)))))....((((............))))..
>2683 see NCBI Nucleotide Schedonorus pratensis symbiont p180 Method 1 (see details)
ATATAACCACTCAAGCTCTCGCTTGGTATTGGGGTTCGCGGTCTCGCGGCCCCTAAAATCAGTGGCGGTGCCTGTCGGCTCTACGCGTAGTAATACTCCTCGCGTCTGGGTCCGACAGGTCTACTTGCCAACAACCCCCAATTTTTTACAGGTTGA
..........((((((....))))))..((((((.(((((....))))).))))))......(((((((((((((((((((.(((((.(((...)))...)))))..))).)))))))))..)).))))).(((((..............))))).
>2684 see NCBI Nucleotide Schedonorus pratensis symbiont p178 Method 1 (see details)
ATTATAACCACTCAAGTCTCGCTTGGTATTGGGGTTCGCGGTCTCGCGGCCCCTAAAATCAGTGGCGGTCTGTCGGCTCTACGCGTAGTAATACTCCTCGCGTCTGGGTCCGACAGGTCTACTTGCCAACAACCCCCAATTTTTTACAGGTTGA
...........((((((...))))))..((((((.(((((....))))).))))))......(((((((((((((((((.(((((.(((...)))...)))))..))).)))))))).....)))))).(((((..............))))).
>166453 see NCBI Nucleotide Epichloe hybrid sp. E187 Method 1 (see details)
ATTTCAACCCTCAAGCCCGCTGCGTGCTTGGTGTTGGGGACCGGCCCGCCCGCCTCGCGGCGGCGGCCGCCCCTGAAATGAATTGGCGGTCTCGTCGCAGCCTCCTTTGCGTAGTAGCACACCACCTCGCAACCGGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTCTCCAAGAGTTGA
..........((((((.((...)).))))))..((((((..(((((.(((.(((....))))))))))).)))))).......(((((((.(((.(((.((((((((((((..((........))..)))))..))))).)).))))))..))))))).........((((((......)))))).
>166454 see NCBI Nucleotide Neotyphodium uncinatum Method 1 (see details)
ATTTCAACCCTCAAGCCCGCTGCGTGCTTGGTGTTGGGGACCGGCCCGCCCGCCTCGCGGCGGCGGCCGCCCCTGAAATGAATTGGCGGTCTCGTCGCAGCCTCCTTTGCGTAGTAGCACACCACCTCGCAACCGGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTCTCCAAGAGTTGA
..........((((((.((...)).))))))..((((((..(((((.(((.(((....))))))))))).)))))).......(((((((.(((.(((.((((((((((((..((........))..)))))..))))).)).))))))..))))))).........((((((......)))))).
>166455 see NCBI Nucleotide Neotyphodium uncinatum Method 1 (see details)
ATTTCAACCCTCAAGCCCGCTGCGCGCTTGGTGTTGGGGACCGGCCCGCCCGCCTCGCGGCGGCGGCCGCCCCCGAAATGAATTGGCGGTCTCGTCGCGGCCTCCTTTGCGTAGTAACATACCACCTCGCAACCGGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTCTCCAAGAGTTGA
..........((((((.((...)).))))))..((((((..(((((.(((.(((....))))))))))).)))))).......(((((((...((((((((((((((((((..((........))..)))))..))))).))..)))))).))))))).........((((((......)))))).
>166456 see NCBI Nucleotide Neotyphodium lolii Method 1 (see details)
ATTTCAACCCTCAAGCCCGCTGCGCGCTTGCTGTTGGGGACCGGCTCACCCGCCTCGCGGCGGCGGCCGCCCCCGAAATGAATCGGCGGTCTCGTCGCAGCCTCCTTTGCGTAGTAACACACCACCTCGCAACCGGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTTCTCCAAGAGTTGA
...........(((((.((...)).)))))...((((((..(((((...(((((....))))).))))).)))))).......(((((((.(((.(((.((((((((((((..((........))..)))))..))))).)).))))))..))))))).........(((((((.....))))))).
Select All

Show entries per page   << Previous    Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.