Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (1882 hits, page 2)

Show entries per page   << Previous    Next >>

Lineage of Hexacorallia: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Metazoa; Eumetazoa; Cnidaria; Anthozoa; Hexacorallia;
Select All
>2827045 see NCBI Nucleotide Montastraea faveolata Method 1 (see details)
ATCATCCATCGCAGGCAAAAACTTGCCGGCGGCGTTGAGGCGTCACGGCCACCCAGTGGGAGCGGCCGTGTCCCTTGAAAGGCAGAGAGACTCACTGCGGTTGCCGGGTTTTTCCCGCGGCACACCAGCGGAGGCTAAAAGTGTGACCAGTCCTTCGCGTGCCGTCGGGTGCCCGCCGCTCGAGTCGCGGAGGCGAAGCATACCTTC
.........(((.(((((....))))).)))((.((((((...(((((((.(((...)))...)))))))..))))))...)).....(((((...(((((....((((....((((((((((....(((((((((............)).))))))))))))).)))).)))))))))..)))))..(((((.........)))))
>2827046 see NCBI Nucleotide Montastraea faveolata Method 1 (see details)
ATCATCCATCGCAGGCAAAAACTTGCCGGCGGCATTGAGGCGTCACGGCCACCCAGTGGGAGCGGCCGTGTCCCTTGAAAGGCAGAGAGACTCACTGCGGTTGCCGGGTTTTTCCCGCGGCACACCAGCGGAGGCTAAAAGTGTGACCAGTCCTTCGCGTGCCGTCGGGTTCCCGCCGCTCGAGTCGCGGAGGCGAAGCATACCTTC
.........(((.(((((....))))).)))((.((((((...(((((((.(((...)))...)))))))..))))))...)).....(((((...(((((....(((.....((((((((((....(((((((((............)).))))))))))))).))))..))))))))..)))))..(((((.........)))))
>2827047 see NCBI Nucleotide Montastraea franksi Method 1 (see details)
ATCATCCATCGCAGGCAAAAACTTGCCGGCGGCGTTGAGGCGTCACGGCCACCCAGTGGGAGCGGCCGTGTCCCTTGAAAGGCAGAGAGACTCACTGCGGTTGCCGGGTTTTTCCCGCGGCACACCAGCGGAGGCTAAAAGTGTGACCAGTCCTTCGCGTGCCGTCGGGTGCCCGCCGCTCGAGTCGCGGAGGCGAAGCATACCTTC
.........(((.(((((....))))).)))((.((((((...(((((((.(((...)))...)))))))..))))))...)).....(((((...(((((....((((....((((((((((....(((((((((............)).))))))))))))).)))).)))))))))..)))))..(((((.........)))))
>2827048 see NCBI Nucleotide Montastraea franksi Method 1 (see details)
ATCATCCATCGCAGGCAAAAACTTGCCGGCGGCGTTGAGGCGTCACGGCCACCCAGTGGGAGCGGCCGTGTCCCTTGAAAGGCAGAGAGACTCACTGCGGTTGCCGGGTTTTTCCCGCGGCACACCAGCGGAGGCTAAAAGTGTGGCCAGTCCTTCGCGTGCCGTCGGGTGCCCGCCGCTCGAGTCGCGGAGGCGAAGCATACCTTC
.........(((.(((((....))))).)))((.((((((...(((((((.(((...)))...)))))))..))))))...)).....(((((...(((((....((((....((((((((((....((((((((((......))))).....))))))))))).)))).)))))))))..)))))..(((((.........)))))
>7800558 see NCBI Nucleotide Madracis decactis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACAGCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACGCACATC
............(((((((...).))))))..((((((.(.((((((((((.((....)).))).)))))))).))))))..........((((((..((((((((((((((..((.(((((....(((((((.(((((....))))).)))))))))))).)).)))).)))).))))))...))))))....(((........))).....
>7800541 see NCBI Nucleotide Madracis mirabilis Method 1 (see details)
CACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACGCACACATC
......((((((......))))))..((((((...((((((((((.((....)).))).)))))))..))))))..........((((((..((((((((((((((..((.(((((....(((((((.(((((....))))).)))))))))))).)).)))).)))).))))))...))))))....(((......))).......
>7800556 see NCBI Nucleotide Madracis decactis Method 1 (see details)
CACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCACCGTGACTGGGGCTTCTTCCCGGCACAGCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACGCACATC
......((((((......))))))..((((((...((((((((((.((....)).))).)))))))..))))))..........((((((..((((((((((((((..((.(((((....(((((((.(((((....))))).)))))))))))).)).)))).)))).))))))...))))))....(((........))).....
>7800557 see NCBI Nucleotide Madracis decactis Method 1 (see details)
CACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACAGCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACGCACATC
......((((((......))))))..((((((...((((((((((.((....)).))).)))))))..))))))..........((((((..((((((((((((((..((.(((((....(((((((.(((((....))))).)))))))))))).)).)))).)))).))))))...))))))....(((........))).....
>7800542 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGAGCTTCTTCCCGGCACAGCAGCGGAGGCTAAAATTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).......
>7800543 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACGCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....(((.((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..).)))........((....((....).))).........
>7800545 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATTACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800548 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACATACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800549 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACAAACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800544 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800546 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800547 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800550 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800552 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800554 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800551 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGATCGCACCTGGGTCGCAGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((.(((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)).))........((....((....).))).........
>7800553 see NCBI Nucleotide Madracis mirabilis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACACCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCGGGCGAACACACACACACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>7800555 see NCBI Nucleotide Madracis decactis Method 2 (see details)
GGATATCACCCATCGCACTTGAGTGTGCGGAGTTGAGGCGTCACGGCCGCCGGCTGTCGCGGGCAGGCCGTGTCCCTCGAAAGGCAGAGAGACCCGCCGTGACTGGGGCTTCTTCCCGGCACAGCAGCGGAGGCTAAAACTCGTTTTGCCCTTCGCGTGCCCGGCGAAGACCTCGGGTCGCACCTGGGTCGCAGGCGAACACACACGAACATC
.............((((((...).)))))(..((((((.(.(((((.(.....(((((...)))))))))))).))))))....).....((((((..(((.((((.((.(...............(((((((.(((((....))))).)))))))).)))))))..)..))..)))))........((....((....).))).........
>6137184 see NCBI Nucleotide Porites compressa Method 3 (see details)
CGCACTCCGTGAGTTCGTGAGTGAGGTATTGCGGTGTGTTAGCGTGCAAGCAAGCAAGCAAGCAAGCATTAAATCGCCGTGTCCCTTGAAGGACAGCAGCATTGGACTCGCATTCTCTATTGAAACTTGAGTGCGAAGGCTAAAGATAATATTTTCCTTCGCCCAAACATGCAATAGCAGAAACAAAATCCAATCAAAGCGGTGG
(((.............)))..((..((.(((.((.....(.(((............(((......))..)....))).)....)).)))...))..))...(((((......((((((((((....(((...(((((((..(((.......))).))))))).))).....)))))).))))......)))))(((......)))
>6137185 see NCBI Nucleotide Porites lobata Method 3 (see details)
CGCACTCGTGAGTTCGTATGTGAGGTGATCGCACGGCGTGCTAGCAAGCAAGCAAGCATTAAATCGCCGTGTCCCTTGAAGGACAGCAGCATTGGACTCGCATTCTCTATTGAAACTTGAGTGCGAAGGCTAAAGATAATATTTTCCTTCGCCCAAACATGCAATAGCAGAAACAAAATCCAATCAAAGCGGTGA
(((....)))..(.(.....(((((......(((((((...(....(((......))..))...)))))))..))))).......).)...(((((......((((((((((....(((...(((((((..(((.......))).))))))).))).....)))))).))))......)))))(((......)))
>6137186 see NCBI Nucleotide Porites lobata Method 3 (see details)
CGCACTCTTGAGTTCGTGTGTGAGGTGTTGCGGTGTGTTAGCAAGCAAGCAAGCATTAAATCGCCGTGTCCCTTGAAGGACAGCAGCATTGGACTCGCATTCTCTATTGAAACTTGAGTGCGAAGGCTAAAGATAATATTTTCCTTCGCCCAAACATGCAATAGCAGAAACAAAATCCAATCAAAGCGGTGA
((......))..(.(.....(((((...(((((((..((....(((......))..)))..)))))))..))))).......).)...(((((......((((((((((....(((...(((((((..(((.......))).))))))).))).....)))))).))))......)))))(((......)))
Select All

Show entries per page   << Previous    Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.