Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (288038 hits, page 3)

Show entries per page   << Previous    Next >>

Lineage of cellular organisms: root; cellular organisms;
Select All
>64456 see NCBI Nucleotide Xenopus borealis Method 1 (see details)
GCTCCGACGTCCATCGCCCCCGCCGGGTCCCCGACCCGGGGAAAACGGGCGGCGCGGCTGGGGCCGTCGCAGGGGTCGAGGGACGCCCCCCCACCGCCCTTCCGGGGGAGGTGAGGGGGCCCCGCGACCCCTTCGTCCCCCCAAGGCCAGACCCCGACCATCCCGGCGGCCCCCCCCAGGGCCCCGGCGCGGCTGTCTGTGGGAAACCGATTTCACGGCTGCCGGCGCCGCGGGCGCTGGGGACCCGCCGGGGCGGGAAGAGCCCCCGGGCGGGCCGGGGCCGGGGAAGGCGCGCTTGAACCCGCGCCCCCCCGCGTCCCCCGCCCGCCCCCCCGCTCGACTCAGA
.............((((((((.(((((((...))))))))).....))))))...((((((((....((.((((((((.(((..((((((.((((.((((....)))).)))).))))))))).)))))))).))...))))..))))....((((.....((((((((....((((((.(((((((((((((.(.((((((((......))))))))).))).)))))).)))).))))))..)))))))).))))..((((....((((((((.((((((((((..((((((........)))))).))))).).)))).))))))))....))))........
>166238 see NCBI Nucleotide Astragalus agrestis Method 2 (see details)
ATCGTTGCCCGATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAAAATCGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTCGAGTTAGCACGATACCGATCATGTGCATGCCCCCAAAATATGGCCTCTATGACCCACACGCGTCTTTTGACGCTCA
((((((((((((.(((((((((...))))))))..).))..)))).))))))......(((((((.((....)))))))))..(((((....(.(((.((((((..((.(((((((((((...(((((.(((.(....).)))))))))))))).))))))).)))).....)).))).)))))).....(((((....)))))...
>166244 see NCBI Nucleotide Astragalus asterias Method 2 (see details)
ATCGTTGCCCAATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGMTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAAAATTGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTCGAGTTAGCACGATACCGATCATGTGCATGCTCTCCAAAAAATGGCCTCCATGACCCACACGCGTCTTTTGACGCTCA
(((((((((((((.((((((((...)))))))).)))....)))).))))))......(((((((.((....)))))))))..(((((.....((((.((((((.(((((((((((((((...(((((.(((...(...))))))))))))))).))))))))))))).....)).))).)))))).....(((((....)))))...
>18366 see NCBI Nucleotide Daucus carota Method 2 (see details)
ACGCATCGTGTTGCCCCTGACCAAACATCTCCTCGAGAGATTTATTTGTTCAGGGGCGGAAATTGGCCTCCCGTGCCTTTTGTGTGCGGTTGGCTCAAAAATGAGTCTCTGGTGACGGGCATCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGTCGTTGTGTATACCCGCCGCAGTAGGGAACTCGAGGGCCCTTGGGCACAGCAAAAATTGTGTGCACTTCGATTGT
.......((.((((((((((.((((.(((((.....)))))...)))).))))))))))..)).((((..((((((.(...).))))))..))))..........(((((((((.((((.(((((((((((((.((((.(...).))))...))).)).)))))).)).)))).)))..))))))..((((((.....(..((((.((((...)))))))))))))))....
>19153 see NCBI Nucleotide Solanum lycopersicum Method 2 (see details)
ACGATCGCGTCGCCCCTCGCACGCCGCAAGGCTTTAGCGCGGGGGCGGAAGCTGGCCTCCCGTGCGCCCCGAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTCTTGTTGTCGCGGCTACAGCCCGTCGCGCGTCCGGACTCCCCGACCCTCACCGCGCCTCACCAGGCGCTCCGACCGCGA
......((.((((((((((((.(((....))).)..))).))))))))..)).((((..((((((((.....))))))))..)))).......(((((.((((((((((.(((((((((((.(((.((((((...))))))....).))))))))))))....).)))))).))))..).)))).(.((........((((((....)))))))).).......
>19550 see NCBI Nucleotide Mimulus glaucescens Method 2 (see details)
GGGTTAATATCACCAATCATTATACTTATGTATAATCACTGGTGGATCTGGCTGTTCCAGCTCTGCCGCAGCCTAGCTGCCTAGTGTGCATCTGGATCTGCTGAAGTATAGAGGCTAACCAAGGACCCGTCAAGGGCCGCAACTGGGTGGGCAGAAATGCTATATTCTTAGTTGTTGGCTTGGGACTTTGCTTGTTCGGCCCTCAAACAGGAACCATTAACCTATTTTCTCGA
.........((((((((.((.(((....))))).))...))))))....(((.(.(((((.((....).....................).))))))..)))........(((((((((((...((((.....((((((((((((((((((((....)))).))..)))))))).)))))))))..)).)...))).)).))))....(((((..(.((...))))))))...
>19718 see NCBI Nucleotide Nicotiana rustica Method 2 (see details)
ACGCATCGCGTCGCCCCCGCACACCGCGCCCATTCTCATGATTGCGGTGGTGTCGTGGGACGGATACTGGCCTCCCGTGTGCCTCGAGCGTGCGGTTGGCCTAAATGCGAGTCCACGGCGACGGACGTCACGACAAGTGGTGGTTGAAACTCAACTCTCGTAATGTCGTGGCTCCAACCCGTCGCATGTTTGGGCTCCCCGACCCTTATCGCGCTTAGGCGCTCCGACCGCGA
....(((.((((.((.(.((((((((((..((.(...)))..)))))).)))).).)))))))))...((((..((((((((.....))))))))..)))).......((((((((((((((((..(((((((((.((((.((((((...)))))).))))..)))))))).).....))))))).)))..)))))).........(..(((((....))))...))......
>20624 see NCBI Nucleotide Populus deltoides Method 2 (see details)
ACGCATCGTCGCCCCCCGCTCCCCTCGGCTCACGAGGGCGGGGGCGGATACTGGTCTCCCGCGCGCTCCCGCTCGCGGCTGGCCCAAAATCGAGTCCTCGGCGACGGTCGCCACGACGAGCGGTGGTTGAGAGACCCTCGGACACTGTCGTGCGGGCCGTCGCCCCGGGATCTTCTGGACCCTCGGCATCGACCTTCTAGGATGCCTCGTTGCGA
..(.(((..((.((((((...((((((.....))))))))))))))))).).((((..(((((.((....)).)))))..)))).......(((((((.((((((((.(.(((((((.((..((((((....))))...)..).)))))))).).)))))))))..)))).)))..........((((((...((...)))))))).........
>65056 see NCBI Nucleotide Xenopus laevis Method 1 (see details)
GACGTCCATCGCCCCCGCCGGGTCCCGTCCCGGCGCGGAGGCGCGGCTGGGGCCGTCGCAGGGGCGCGCCGCTCCCCTTCGTCCCCCCAAGGCCAGACCCCCGGCCCGGCGCCCGGGCCCCGGCCCGGCCGGCGGCGGCTGTCTGTGGATCCCTTCACGGCTGCCGCCCCGGCCGGCCCCCCGGGGCCCCGGCCCGCCGGCGGGAGCGGGCCCGGCCCCCCCCCCCGGGCCGCGGCCCCGCGCCCCCCCCCCCCCCCACGAC
.........(((((((((((((......))))))).)).)))).((((((((....((.(((((.((...)).))))).))...))))..))))...((((((((..((.(((.(((((((((.((((((((.((((((.(.(((((((....)))))))).))))))))))))))....))))))))).)))))))))).))).(((((((((((((........)))))).)).))))).....................
>64487 see NCBI Nucleotide Xenopus laevis Method 2 (see details)
GCTCCGACGTCCATCGCCCCCGCCGGGTCCCGTCCCGGCGCGGAGGCGCGGCTGGGGCCGTCGCAGGGGCGCGCCGCTCCCCTTCGTCCCCCCAAGGCCAGACCCCCGGCCCGGCGCCCGGGCCCCGGCCCGGCCGGCGGCGGCTGTCTGTGGATCCCTTCACGGCTGCCGCCCCGGCCGGCCCCCCGGGGCCCCGGCCCGCCGGCGGGAGCGGGCCCGGCCCCCCCCCCCGGGCCGCGGCCCCGCGCCCCCCCCCCCCCCCACGACTCAGA
..............((((((((((((((...).))))))).)).)))).((((((((..(.((.(((((.((...)).))))).)))..))))..))))...((((((((..((.(((.(((((((((.((((((((.((((((.(.(((((((....)))))))).))))))))))))))....))))))))).)))))))))).))).(((((((((((((........)))))).)).)))))..........................
>166236 see NCBI Nucleotide Astragalus adsurgens Method 1 (see details)
ATCGTTGCCCAATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTYGCGGTTGGTTGAAAATCGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTCGAGTTAGAACGATACCGATCATGTGCATGCTCCCCAAAATATGGCCTCTATGACCCACACGCGTCTTTTGACGCTCA
(((((((((((((.((((((((...)))))))).)))....)))).))))))((((..((((..((......))...))))..)))).......(((.((((((..((((((((((((((....((((.((......))....)))).)))))).)))))))).)))).....)).)))............(((((....)))))...
>166240 see NCBI Nucleotide Astragalus alpinus Method 1 (see details)
ATCGTTGCCCGATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCTTAGTTGCCTCACGGTTGGTTGAAAATTGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTCGAGTTCGCACGATACCGATCATGTGCATGCTCCCCAAAATATGGCCTCTATGACCCACACGTGTCTTTTGACGCTCA
((((((((((....((((((((...))))))))........)))).))))))......((((((((......).)))))))..(((((......(((.((((((..((((((((((((((....((((.(((........))))))).)))))).)))))))).)))).....)).)))..))))).....(((((....)))))...
>166246 see NCBI Nucleotide Astragalus bisulcatus Method 1 (see details)
ATCGTTGCCCGATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAAAATCGAGTCCTTGGTGGGGTGTGCCATGATAGATGGTGGTCGAGTTAGCACGATACCGATCGTGTGCATGCTCCCCAAAATATGGCCTCTATGACCCACACGCGTCTTTTGACGCACA
((((((((((....((((((((...))))))))........)))).))))))((((..(((((((.((....)))))))))..)))).......(((.((((((.(((((((((((((((....((((.(((........))))))).)))))).))))))))))))).....)).)))............(((((....)))))...
>20404 see NCBI Nucleotide Ostrya virginiana Method 3 (see details)
TTGCCCCCAACCCCTCCGCCTCTTCGAGAGACGAGGGCAGTTTGCGGGGCGGACATTGGCCTCCCGTGAGCTTCCACTCGCGGCTGGCCTAAAAGCGAGTCCTAGGCGACGAGCGCCACGACAATCGGTGGTTGTAAAACCCTCGTGTCCCGTCGTTCGCGCCTCGTCGCTCATCTTGTGCTCTGTGACCCTGTAGCGTCGCGATCGCGACTCTTCCAATCG
((((((((((.((((.((.((((...)))).)).)))..).))).))))))).....((((..(((((((.(...))))))))..)))).....(((((....(((((((((((((.(((((.(((((.((((....)))).))).))...)))))..))).)))))))))..))))))....(..(....(.(((.(((((....))))).))...))).)
>18451 see NCBI Nucleotide Fragaria x ananassa Method 3 (see details)
CGTCGTTGCCCCCCTGACCCCTTCGGGGTCGGACGGGACGGATGATGGCCTTCCCGTGTGCCCCGTCACGCGGTTGGCATAAATACCGAGTCCTCGGCGACCGGCGGTCCGGCGATCGGTGGTTGTCAAACCTCGGTGCCTTGTCGCGTGCGTGAGTCGATCGCGGGACTTCCTTAGCCGTAAGCGCGTCGGTAACCCGACGTTT
(((((((.(((..((((((((...))))))))..)))...)))))))(((...((((((((...).)))))))..))).........(((((((((((((((.(((((.((((((((((.((((....)))))))))....))))).)).)))).)))).))).)))))))..........((((..(((((....)))))))))
>18866 see NCBI Nucleotide Hordeum vulgare Method 3 (see details)
CGCTCCCAACCACCCTCTTCGGGAATTGGGATGCGGCATATGGTCCCTCGTCCTGCAAGGGGCGGTGGGCCGAAGATCGGGCTGCCGGCGTACCGCGTCGGACACAGCGCATGGTGGGCGTCCTTGCTTTATCAATGCAGTGCATCCGACGCGTAGACGGCATCATGGCCTCGAAACGACCCATCGAACGAAGTGCACGTCGCTTCGAC
(((((((((...(((.....)))..)))))).))).....((((((.(((((((....))))))).))))))....(((((((((((.(.((.((((((((((((.(((..(((((((((....))).)))))).))).)))..)))))))))))).)))).....)))).)))...........(..(((((((.....))))))).)
>21638 see NCBI Nucleotide Triticum aestivum Method 3 (see details)
GCCAAAACACGCTCCCAACCACTCTCAACGGGAATCGGGATGCGGCATCTGGTCCCTCGTCTCTCAAGGGACGGTGGACCGAAGATTGGGCTGCCGGCGTACCGCGCCGGACACAGCGCATGGTGGGCGTCCTCGCTTTATCAATGCAGTGCATCCGGCGCGCAGCTGGCATTATGGCCTTTGAACGACCCAACAAACGAAGCGCACGTCGCTTCG
(((.......((((((.(...(((.....)))..).)))).)))))...((((((.(((((((....))))))).))))))......(((((((((((.(..((((((((((((.(((..(((((((((....))).)))))).))).)))..))))))))).))))))).....))))).................(((((((.....)))))))
>21222 see NCBI Nucleotide Secale montanum Method 3 (see details)
CGCTCCCACACCCCTCATTGGGAATCGGGATGCGGCATCTGGTCCCTCGTCTCGCAAGGGGCGGTGGACCGAAGTTCGGGCTGCCGGCGTACCGTGTCAAACACAGCGCGTGGTGGGCGTCTTTGCTTTATCAACGCAGTGCATACGACGCGTAGCCGGCATGATGGCCTCAAAACGACCCAACAAACGTAGCGCACGTCGCTTCGA
(((((((..(.(((.....)))..).)))).))).....((((((.(((((((....))))))).))))))....(((...(((((((.((.((((((..((((.(((..(((((((((....))).)))))).))).)))..)..)))))))))))))))))).....((.((.((((.(..(.(...).).)...)))).)).))
>17923 see NCBI Nucleotide Betula pendula Method 3 (see details)
TTGCCCCCAACCCCATCTCCTTGCAAAGGGACGAGGGGGCCTGTGGGGCAGAAATTGGCCTCCCGTGAGCTCATGCATGCGGTTGGCCTAAAAGCGAGTCCTCGGCGACGCGCGCCACGACAATCGGTGGTTGTCAAACCCTCGTGTCCCGTCGTGCGTGCGTGCGCGTCGCTCATCGTGTGCTCCTTGACCCTGCTTGTGTCGCGCTAGCGAAGC
(((((((..(((((.(((.(((....)).)).)))))).....)))))))).....((((..(((((.((....)).)))))..))))...(((.(((.(.((((((((((((((((((((.(((((.((((....)))).))).))...)))))).))))....))))))))....).).)))))))..........((.((((....)))).))
>161032 see NCBI Nucleotide Schistosoma bovis Method 3 (see details)
TCACGGCGCACATTGAGTCGTGGATTGGGCGAGTGCTGCCGGCGTGTATACCCGCATATCAACGCGGGTTGCTGGTCAAAGGCTCCGTCCTAATAGTCGCCACAGCCTAGTCCGGTCTAGATGACTTGATTGAGATGCTGCGGTGGGTTGTGCTCGAGTCGTGGCTTAATGACATTATACACGCTCGGGAAGAATCGCACCTATCGTACGCTACGTTGGTCACTTGATCTTGTCTCTATGGTTCGGTCTATGGTTTGTACCGATGGTGTGTGTAATACGCACGA
(((((((.((...)).)))))))...(((((.(.((((((((((.....((((((.(...)..)))))))))))))...)).)).)))))........(..(((((((((.((((.(((((.(((..((((((((((((((((((((((((.((((((.((((..(((((...)))).)))))))))))...).).).)))))))))).)).)..)......)))))))..)))))..))).)))).))).)).)))).)...(.(((((((...))))))).)
>21968 see NCBI Nucleotide Aegilops speltoides Method 3 (see details)
ACGCCAAAACACGCTCCCAACCACCCTCATCGGGAATCGGGATGCGGCATCTGGTCCCTCGTCTCGCAAGGGGCGGTGGACCGAAGATCGGGCTGCCGGTGTACCGCGCCGGACACAGCGCATGGTGGGCGTCCTCGCTTTATCAACGCAGTGCATCCGACGCGCAGCCGACATTATGGCCTCAGAACGACCCAGCAAACGAAGCGCACGTCGCTTCGAC
(.(((.......((((((.(...(((.....)))..).)))).))))).).(((((.((((((((....))))))).))))))......((((((.((((....((((.(((((((.(((..(((((((((....))).)))))).))).)))..)))).))))..)))).).....)))))............(....(((((((.....))))))).)
>21157 see NCBI Nucleotide Sinapis alba Method 1 (see details)
ACAAATCGTCGTCCCCCCATCCTCTCGAGGATATGGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGTTTTGGAGCGTCTCGACATGCGGTGGTGAATTGTAACCTCGTCATATTGTCGGTCGTTCCGGTTCAAAAGCTCTTGATGACCCAAAGTCCTCAACGCGA
........(((((((...(((((....)))))..)))))))....(((((..((((((((....))))))))..)))))......(((((...((....((((((((..((((((.((((.(((........))))))).....)))))).)))))))).))...))))).(((.(((.....))).)))......
>21158 see NCBI Nucleotide Sinapis alba Method 1 (see details)
ACAAATCGTCGTCCCCCCATCCTCTCGAGGATATGGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGTTTTGGAGCGTCTCGACATGCGGTGGTGAATTGTAACCTCGTCATATTGTCGGTCGTTCCGGTTCAAAAGCTCTTGATGACCCAAAGTCCTCAACGCGA
........(((((((...(((((....)))))..)))))))....(((((..((((((((....))))))))..)))))......(((((...((....((((((((..((((((.((((.(((........))))))).....)))))).)))))))).))...))))).(((.(((.....))).)))......
>22033 see NCBI Nucleotide Vicia faba Method 1 (see details)
ACATATCGAAGCCTCCTTGCCAATTTCCCTGATTATTGTGCAGGGTGGATGTTGGCCTCCCGTGAGCTCTTTCGTCTCATGGTTGGTTGAAAATTGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACCCACGAGACCAATCATGCGCTGCTCTATTGAATTTGGCCTCCTTTACCCATATGCGTTTCCAAACGCTCGTGATGAGA
...........((.((((((((((.((...))..)))).)))))).))...((((((..((((((((......).)))))))..)))))).....(((.(((((((((((((.((((((((......(((((.((((...)))).))))))))))).)))))))))))))....)).))).......(((..(((((....)))))..)))......
>22071 see NCBI Nucleotide Vigna radiata var. radiata Method 1 (see details)
ACACATCGTCATCCCCATGCAAAAGCGCATCGGGCGAAAGGTGGCCTCCCGCGACACACCCGTCGTGGTTGGTCGAAAACCAAGGTAACGTCGGGGTCCCCCCCGCCAGAAACGGTGGATGAGCAACGCTCGAGACCAACAACGGCGGCGGCGGACACCCGGCAATCCAATCGATCGACCCTATCGCGTTCCTTGCATAATAAACAGGCAAAGACGCTCTTAACGA
...((((.((..(((.((((......)))).))).))..)))).....(((((((......)))))))..((((((.......((....((((((((((((.(((((......(((...(((((...)))))..)))......))))).)).)))).))))))...))......)))))).....(((((..((((...........)))).))))).........
Select All

Show entries per page   << Previous    Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.