Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (136 hits, page 1)

Show entries per page      Next >>

Lineage of Colletotrichum capsici: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreomycetidae incertae sedis; Glomerellaceae; mitosporic Glomerellaceae; Colletotrichum; Colletotrichum capsici;
Select All
>2533 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>2535 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..(((((((((((((.(((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>82799408 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>82799410 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>38606403 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>92429588 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>92429589 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>92429590 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>92429591 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
>82799412 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTG
(((.(((((((((((((.((((...(((..((((.((..((.....))))))))..))))))))))))..))).)))))...)))..(((((((...)))))))
>76886554 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCC
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886555 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCC
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886549 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886550 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886551 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886552 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886553 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886556 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886557 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>76886558 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>89573794 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>89573795 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>89573796 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>89573797 see NCBI Nucleotide Colletotrichum capsici Method 3 (see details)
GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCT
(((((....)))))...((((.(((...))).))))..(((((((..(((...(((((((((....))))))))))))..)))))))..(.(...(((((..((((((...)))))).))))).).)
>92429614 see NCBI Nucleotide Colletotrichum capsici Method 1 (see details)
ATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACATTTCGTCTCGCATTGGGATTCGGAGGGACTCTAGCCGTAAAACCCCCAATTTTACTAAGGTTGA
....((((..((((((...)))))).))))((((.(((((.....))))))))).....(((..((((((((((((.((((...((((.((((.((..((.....))))))))..)))))))))))))..))).))))....)))..(((((((...))))))).
Select All

Show entries per page      Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.