Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (5016 hits, page 1)

Show entries per page      Next >>

Lineage of Cortinariaceae: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Cortinariaceae;
Select All
>1843466 see NCBI Nucleotide Cortinarius allutus Method 2 (see details)
ATTAATAATATATCAATCTCTTCAGCTTTTGGTTGTTGAGTGTTGGATGTGGGGGTCATTTTTTTTTGCTGGTCTTTTCAAAGGTCAGCTCCCCTGAAATGCATTAGCGGAACAATTTGTGGACCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAACAGTTCAGCTTCTAACAGTCTATTGAATTGGACAAATTTTCATTAATGTGA
............((((((((..(((((...)))))..))).)))))....(((((..(.........((((((((.(...)))))))))))))))..........(((.((((..((((((......(((.(((((((((....))).)))))).)))))))))...)))).)))........(.((((((..((((.(...))))))))))).).
>1843467 see NCBI Nucleotide Cortinarius californicus Method 2 (see details)
ATTAATATATATCAACCTCTTCTTTGTTGAAGTGGTTTGGATGTGGGGGGTTTGCTGGCCTTTTAAAAGGTCAGCTCCCCTGAAATGCATTAGCAGAACAACCTGTTCATTGGTGTGATAACTATCTACGCTATTGAACAGTGAAGGCAGTTCAGCTTCTTAACAGTCCTTGGACAATTTATCATTTATGTGA
........(((((((((.((((......)))).))))..))))).(((((...(((((.((((...))))))))).)))))..........(((.((((..((((((((.(((((((((....))).)))))).))))).....)))..)))).)))........(((....)))..................
>1843468 see NCBI Nucleotide Cortinarius caninus Method 2 (see details)
ATTAATATATCAACCTCTTCAGCTTTTGCTTGTTGAGTGTTGGATGTGGGGGTCCTTTTTGCTGGTCTTTTCAAGAGGTCAGCTCCCCTAAAATGTATTAGCGGAACAATTTGTTGACCGTTCATTGGTGTGATAATTATCTACGCTATTGACGTGAGGCAGTTCAGCTTCTAACAGTCCATTGACTTGGACAGCTTTTTATTAATGTGA
.........((((((((..((((....))).)..))).)))))...((((((........(((((..((((...))))))))).))))))...(((..((((.((((....(((((..((.(((.(((((((((....))).)))))).)))))))..))))))).)))...)))).((((((((..((((....)))..))))))).))
>1843469 see NCBI Nucleotide Cortinarius delibutus Method 2 (see details)
ATTAATATATCAACTTCTTCAGCTTTTGCTTGTTGAGTGTTGGATGTGGGGGTTTTGCTGGCCTTTCTAAAGGTCAGCTCCCCTGAAATGCATTAGCGGAACAATTTGTTGACTGTTCATTGGTGTGATAATTATCTGCGCTATTGAACTGTGAGGCAAGTTCAGCTTCTAATAGTCCATTGACTTGGACAAATTTTTTCATTTAATGTGA
......(((((((((((..(((.(...).)))..))).))).)))))(((((....(((((((((....))))))))).)))))..........(((.((((...(((((..((((.((.(((((((((....))).)))))).)))..)).).))))))))).)))....(((.(...((((...(((....))).)).)...)))))..
>1843471 see NCBI Nucleotide Cortinarius limonius Method 2 (see details)
ATTAATATATCAACCTCTTCAACTTGCTTGTTGAGTGTTTGGATGGTTGGGGGGTCATTTTTTGCTGGTCTCTTTCCTGAAGTCAGCTCCCCTGAAATGCATTAGCAGAACAATTTGTGGACCCGTTCATTGGTGTGATAAATATCTACGCTATTGACGTTAAGCAGTTCAGCTTCTAACAGTTCATTGACTTGGACAATATCATTAATGTGA
......(((((((((((..(((.....)))..))).)))..))))..)(((((...(......((((((.((......)).))))))))))))........((((.((..((((.(((.((..(((.((.(((((((((....))).)))))).)))))))..))))))..))).))))..(((((......)))))................
>1843472 see NCBI Nucleotide Cortinarius limonius Method 2 (see details)
ATTAATATATCAACCTCTTCAACTTGCTTGTTGAGTGTTTGGATGGTTGGGGGGTCATTTTTTGCTGGTCTCTTTCCTGAAGTCAGCTCCCCTGAAATGCATTAGCAGAACAATTTGTGGACCCGTTCATTGGTGTGATAAATATCTACGCTATTGACGTTAAGCAGTTCAGCTTCTAACAGTTCATTGACTTGGACAATATCATTAATGTGA
......(((((((((((..(((.....)))..))).)))..))))..)(((((...(......((((((.((......)).))))))))))))........((((.((..((((.(((.((..(((.((.(((((((((....))).)))))).)))))))..))))))..))).))))..(((((......)))))................
>1843482 see NCBI Nucleotide Dermocybe crocea Method 2 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTACTTGTCGAGTGTTTGGATGTGGGGGTTTCTTTTGCTGGTCTCTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAATATCTACGCTTTTGACGTGAAACAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAATTTTTCATTAATGTGA
.........((((((((..((((.(...)))))..))).).))))...((((((........(((((((((...))))))))).)))))).......((((.((..(((((((((..(.(((.((..((((((((...))).)))))..))))).)).)))))))..))).)))).....((((((..((((.(...)))))))))))...
>1843484 see NCBI Nucleotide Dermocybe cinnamomeolutea Method 2 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTACTTGTCGAGTGTTTGGATGTGGGGGTTTCTTTTGCTGGTCTCTTTTGAGGTCTGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTTTTGTGGTGAAACAGGTTCAGCTTCTAACAGTCCATTTACTTGGACAAATTTTCATTAATGTGA
.........((((((((..(((..(...))).)..))).).))))...((((((........((.((((((....)))))).)).))))))...((..(((((.((((...(((((.(.(((..((..((((((((....))).)))))..)))))).).)))))))).)))...)))).((((((.(..((((....)))..)).)))).))
>1843485 see NCBI Nucleotide Dermocybe fervida Method 2 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTACTTGTTGAGTGTTTGGATGTGGGGGTATTTTTTGCTGGTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAAACTATCTACGCTATTGACGTGAAGCAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGTGA
.........((((((((..(((..(...))).)..))).).))))...((((((.(......(((((((((....))))))))))))))))...((..(((((.((((...(((((.(.(.(.(((.((((((((((...)))).)))))).)))))).).)))))))).)))...)))).((((((((..((((....)))..))))))).))
>1843486 see NCBI Nucleotide Dermocybe fervida Method 2 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTACTTGTTGAGTGTTTGGATGTGGGGGTATTTTTTTGTTGGTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTTTTGACGCGAACGAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGTGA
.........((((((((..((((.(...)))))..))).).))))...((((((.(.......(((((((((....)))))))))))))))).......((((.((..((((((..((.(.(((.((..((((((((....))).)))))..))))).)..)))))))..))).)))).....((((((..((((.(...)))))))))))...
>1843489 see NCBI Nucleotide Dermocybe malicoria Method 2 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTACTTGTTGAGTGTTTGGATGTGGGGGTATTTTTTGCTGGTCTTTTTCGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTTGTTGACCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCATGTTCAGCTTCTAATTGTCCATTGACTTGGACAAATTTTCATTAATGTGA
.........((((((((..(((..(...))).)..))).).))))...((((((.(......(((((((((....))))))))))))))))....(..(((((.(((((....((((.((.(.(((.(((((((((....))).)))))).)))))).).)))))))).)))...)))..((((((((..((((....)))..))))))).))
>1843490 see NCBI Nucleotide Dermocybe mallochii Method 2 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTACTTGTCGAGTGTTTGGATGTGGGGGTCTCTTTTGCTGGTCTCTTTTGAGTTCAGCTCCCCTGAAATGCATTAGTGGGAACAATTTGTTGACTCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCAGGTTCTGCTTCTAACGGTCCATTGACTTGGACAAAATTTCATTAATGTGA
.........((((((((..(((..(...))).)..))).).))))...((((((........(((((.(((....))).))))).))))))...((..(((((.(((((...(((((.((..(.(((.(((((((((....))).)))))).)))))).).))))))))))))...)))).((((((((..((.(.....))..))))))).))
>1843493 see NCBI Nucleotide Dermocybe olivaceopicta Method 2 (see details)
ATTAATATATCAACCTCCTCAAGTTTTGCTTGTTGAGCGTTGGATGTGGGGGGGTTTTTTTTGCTGGTCTCTCTTTCTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACAATTTGTTGACCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCAGGTTCAGCTTCTAATAGGTCCATTGACTTGGACAAATTTTCATTAATGTGA
.........((((((((..((.((...))).)..))).)))))...((((((.(........(((((..((((.....))))))))))))))))...((..(((((.((((...(((((.((.(.(((.(((((((((....))).)))))).)))))).).)))))))).)))...))))..((((((((..((((....)))..))))))).))
>1843494 see NCBI Nucleotide Dermocybe olivaceopicta Method 2 (see details)
ATTAATATATCAACCTCTTCAAGTTTTGCTTGTTCAGTGTTGGATGTGGGGGTTCTTTTGCTGGTCTCTCTTTCTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACAATTTGTTGACCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCAGGTTCAGCTTCTAATAGGTCCATTGAATTGGATAAATTTTCATTAATGTGA
......((((((((((...(.(((...).)))...)).))).)))))(((((.......(((((((((.......))))))))).)))))..........(((.((((...(((((..((((.((.(((((((((....))).)))))).))))).).))))))))).)))....((.(.(...(((((..(.(....))))))..)))))..
>1843487 see NCBI Nucleotide Cortinarius idahoensis Method 2 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTACTTGTCGAGTGTTTGGATGTGGGGGTATCTTTTGCTGGTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGTGA
.........((((((((..(((..(...))).)..))).).))))...((((((.(......(((((((((....))))))))))))))))...((..(((((.((((...(((((.(.(.(.(((.(((((((((....))).)))))).)))))).).)))))))).)))...)))).((((((((..((((....)))..))))))).))
>1843488 see NCBI Nucleotide Dermocybe malicoria Method 2 (see details)
ATTAATATATCAACCTCCTCAAGTTTTTACTTGTTGAGTGTTTGGATGTGGGGGTATTTTTTGCTGGTCTCTTATGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTTGTTGACCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCATGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGTGA
.........((((((((..((.(.(...))).)..))).).))))...((((((.(......(((((..(((....)))))))))))))))...((..(((((.(((((....((((.((.(.(((.(((((((((....))).)))))).)))))).).)))))))).)))...)))).((((((((..((((....)))..))))))).))
>1843470 see NCBI Nucleotide Cortinarius gentilis Method 1 (see details)
ATTAATATTATATATCAAACCCTCTTTTTCTGAGTGGTTTGGATGTGGGGGTGCTGGCCTCTTGAAGGGGTCAGCTTCCCCTGAAATACATTAGCAGAACGACCTGTTTGTTCATTGGTGTGATAACTATCTACGCTATTGAACGTGAAGGCAGTTCAGCTTCCTAACAGTCTTTGGACAATTTATCAACTATGT
..............((((((((((.......))).)))))))....(((((.((((((((((...))))))))))..)))))..........(((.((((..(((...((((((.(((((((((....))).)))))).))))))...)))..)))).)))........(((....)))................
>1843473 see NCBI Nucleotide Cortinarius miniatopus Method 1 (see details)
ATTAATATCTATATCAACCTTCTCTTGTAGAGTGTGGTTTGGATGTGGGGGTTTGCTGGCCTCTTTAAAGGTGTCAGCTCCCCTGAAATGCATTAGCGGAACAACCTCGTTCATTGGTGTGATAACTATCTACGCTATTGGATGTGAGGGACAGTTCAGCCGTCTAACAGTCCTCGGACAATTTATCATCATTAATGT
....(((((((.((((.....((((...))))..)))).)))))))(((((...((((((.(((....))).)))))).)))))...........((.((((..(((((((((.(((((((((....))).)))))).))))..)))))....)))).)).((((..........))))...................
>1843474 see NCBI Nucleotide Cortinarius paragaudis Method 1 (see details)
ATTAATATATATATCAACCCCCCTCTTGTTGAGCGGGTTTGGATGTGGAGGTTTTTGCTGGCCGCTTAAAAAAGGGTTCAGCTCCTCTGAAATACATTAGCGGGACAAGCCTGTCCATTCATTGGTGTGATAAATATCTACGCTGTTGAATGTGAGGCAGTTCAGCTTTCCAACAGTCCTTTGGCAAACCTATCATTTTATGT
.............((((.(((.(((.....))).))).))))....(((((.....(((((((.(((....))))).))))).)))))..........(((.((((..((((...((((((.(((((((((....))).)))))).))))))..)))).)))).)))..((((.......))))...................
>1843476 see NCBI Nucleotide Cortinarius umbilicatus Method 1 (see details)
ATTAATATCTATATCAACCCTCCTTCTCTTGTGTAGGAGTGGTTTGGATTTGGGGGTTTGCTGGCCTCTTTAAAAGGTTCAGCTCCCCTGAAATGCATTAGCAGAACAATCCTTGTTCATTGGCGTGATAACTATCTATGCTATTGAATGTGAGGTGCAGTTCAGCTTTCTAACAGTCCTTTGGACAAATTTATCATTAATGT
.......((((....(((((((((..........))))).))))))))((((((((...((((((((.......))).))))).)))))))).......(((.((((...(((((((((.(((((((((....))).)))))).)))))..))))....)))).)))........((((...)))).................
>1843477 see NCBI Nucleotide Cortinarius vibratilis Method 1 (see details)
ATTAATATAATCAAACCTCTAGTTTTTTCTGGAGTGTTTGGATGTGGGGGTTTTTGTTGGCCTTTATTTTCTGAAGGTCAACTCCTCTGAAATGTATTAGCGGAACAGTTAACTGGGTTCATTGGTGTGATAATTATCTACGCTATTGACAATGGATAACAAGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTTTCATTAATGT
......(((.((((((((((((......)))))).)))))).)))(((((.....(((((((((((.....))))))))))).)))))....(((...(((.((((.((((.(((.((.((.(((((((((....))).)))))).))))..))).))))..)))).)))....)))(((((......)))))..................
>1843481 see NCBI Nucleotide Dermocybe aurantiobasis Method 1 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTACTTGTCGAGTGTTTGGATGTGGGGGTTTCTTTTGCTGGTCTCTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAATATCTACGCTTTTGACGTAAAACAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAATTTTTCATTAATGT
......(((((((((((..(((((....)))))..))).)))..)))))(((((........(((((((((...))))))))).)))))..........(((.((((...(((((....(((.((..((((((((...))).)))))..)))))...))))))))).))).......(((((......)))))................
>1843483 see NCBI Nucleotide Cortinarius cinnamomeus Method 1 (see details)
ATTAATATATCAACCTCCTCAGGTTTTTGACTTGTCGAGTGTTTGGATGTGGGGGTCTTTTGCTGGTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTTTTGAGGTGAAACAGGTTCAGCTTCTAACAGTCCATTGATTTGGACAAATTTTCATTAATGT
......(((((((((((..((((((...))))))..))).)))..)))))(((((......(((((((((....))))))))).)))))..........(((.((((...(((((.(((...(((..((((((((....))).)))))..))))))..))))))))).))).......(((((......)))))................
>1843491 see NCBI Nucleotide Dermocybe marylandensis Method 1 (see details)
ATTAATATATCAACCTCTTCAGGTTTTACTTGTAGAGTGTTTGGATGTGGGGGTATCTTTTGCTGGTCTCTTCTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTTAAGCAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGT
......((((((((((((.(((((...))))).)))).)))..)))))(((((........(((((((((....))))))))).)))))..........(((.((((...(((((....(((.((.(((((((((....))).)))))).)))))...))))))))).))).......(((((......)))))................
>1843492 see NCBI Nucleotide Dermocybe marylandensis Method 1 (see details)
ATTAATATATCAACCTCTTCAGGTTTTACTTGTAGAGTGTTTGGATGTGGGGGTATCTTTTGCTGGTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTTAAGCAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGT
......((((((((((((.(((((...))))).)))).)))..)))))(((((........(((((((((....))))))))).)))))..........(((.((((...(((((....(((.((.(((((((((....))).)))))).)))))...))))))))).))).......(((((......)))))................
Select All

Show entries per page      Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.