Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (76 hits, page 1)

Show entries per page      Next >>

Lineage of Hyphodontia: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Corticiales; Corticiaceae; Hyphodontia;
Select All
>5734057 see NCBI Nucleotide Hyphodontia radula Method 1 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTATAATCGTCCTTCACGGGACAATTTGATCTTTTTGA
.........(((((((((((((......)))))).))).))))....(((((..((((((....)))))).)))))......(((.(((((((...(((((((.(((...(((((((((((((...)))).)))))))))))))))))))))))))).)))...(((((....)))))................
>5070527 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).)))..))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070542 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).)))..))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070529 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).))........................
>5070530 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGA
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070533 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTCTGAATAGTGATTAGCTCGGAATTTGATTCGCAGCATATCATGCGGTGTGATAATGTCGTCACATGCTGTAGCTCGGATTCTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGA
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).)))))..)..........((((.(((....((((((.(((...(.((((((((((((...)))).))).)).))))))))))))).)))))))((.(((.(((((....))))).))).)).........................
>5070534 see NCBI Nucleotide Hyphodontia paradoxa Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTGTTGAAAGGTGAGCTTGGACTTGGGGACTTGCTGGTTTTCAATCAGCTTCCCTTGAATGCATTAGCTGGACTTTGATTTGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCAAGTCGTTTGGCTTCTAATCGTCCTTTCACGAGGACATTCTGATCAATTAGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((...(((((((...))))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.((((((....))))))).).))).........................
>5070535 see NCBI Nucleotide Hyphodontia paradoxa Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTGTTGAAAGGTGAGCTTGGACTTGGGGACTTGCTGGTTCTCAATCAGCTTCCCTTGAATGCATTAGCTGGACTTTGATTTGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCAAGTCGTTTGGCTTCTAATCGTCCTTTCACGAGGACATTCTGATCAATTAGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((...(((((((...))))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.((((((....))))))).).))).........................
>5070536 see NCBI Nucleotide Hyphodontia flavipora Method 2 (see details)
GTGAAATTATCAACTCCTATTCTTTATTGAATGGTGAGCTTGGATTTGGAGATTGCTGGTGAAAATCGGCTTCTCTTGAATGAATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCTTTCATGGACAATTTGATCATTTTGACCTCAAATCAGGTAGA
.........(((((((((((((......)))))).))).)))).((.(((((..((((((....)))))).))))).)).......(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.((((.....)))).))).)).........................
>5070537 see NCBI Nucleotide Hyphodontia flavipora Method 2 (see details)
GTGAAATTATCAACTCCTATTCTTTATTGAATGGTGAGCTTGGATTTGGAGATTGCTGGTGAAAATCGGCTTCTCTTGAATGAATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGGTTGTCTGGCTTCTAATCGTCTTTCGTGGACAATTTGATCATTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).)))).((.(((((..((((((....)))))).))))).)).......(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.((((.....)))).))).)).........................
>5070538 see NCBI Nucleotide Hyphodontia flavipora Method 2 (see details)
GTGAAATTATCAACTCCTATTCTTTATTGAATGGTGAGCTTGGATTTGGAGATTGCTGGTGAAAATCGGCTTCTCTTGAATGAATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCTTTCATGGACAATTTGATCATTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).)))).((.(((((..((((((....)))))).))))).)).......(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.((((.....)))).))).)).........................
>5070548 see NCBI Nucleotide Hyphodontia flavipora Method 2 (see details)
GTGAAATTATCAACTCCTATTCTTTATTGAATGGTGAGCTTGGATTTGGAGATTGCTGGTGAAAATCGGCTTCTCTTGAATGAATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCTTTCATGGACAATTTGATCATTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).)))).((.(((((..((((((....)))))).))))).)).......(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.((((.....)))).))).)).........................
>5070528 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070531 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070532 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070539 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070540 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070541 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070543 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070544 see NCBI Nucleotide Hyphodontia radula Method 2 (see details)
GTGAAATTATCAACTCCCTTTCTTTATTGAAGGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATTGGCTTCCCTTGAATGTATTAGCTGGAATTTAATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070545 see NCBI Nucleotide Hyphodontia nothofagi Method 2 (see details)
GTGAAATTATCAACTCCTTTTCTTTATTGAAAGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATCAGCTTCTCTTGAATGCATTAGCTGGAATTTGATTTGTAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTTGAATTGTCTAGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070546 see NCBI Nucleotide Hyphodontia nothofagi Method 2 (see details)
GTGAAATTATCAACTCCTTTTCTTTATTGAAAGGTGAGCTTGGACTTGGGGATTGCTGGTGCAAATCAGCTTCTCTTGAATGCATTAGCTGGAATTTGATTCGTAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTTGAATTGTCTAGCTTCTAATCGTCCTTCACGGGACAATTTGATCTTTTTGACCTCAAATCAGGTAGG
.........(((((((((((((......)))))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(((.(((((....))))).))).)).........................
>5070547 see NCBI Nucleotide Hyphodontia tropica Method 2 (see details)
GTGAAATTATCAACTCCCATTCTTTGTTGATTGGTGAGCTTGGACTTGGGGATTGCTGGCGCAAGTCTGCTTCCCTTGAATGAATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGACAACTTGATCTTTTGACCTCAAATCAGGTAGG
.........((((((((((.((......)).))).))).))))..(.(((((..((.(((....))).)).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(.(.((((.....)))).).).))........................
>5070549 see NCBI Nucleotide Hyphodontia tropica Method 2 (see details)
GTGAAATTATCAACTCCCATTCTTTGTTGATTGGTGAGCTTGGACTTGGGGATTGCTGGCGCAAGTCTGCTTCCCTTGAATGAATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGACAACTTGATCTTTTGACCTCAAATCAGGTAGG
.........((((((((((.((......)).))).))).))))..(.(((((..((.(((....))).)).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(.(.((((.....)))).).).))........................
>5070550 see NCBI Nucleotide Hyphodontia tropica Method 2 (see details)
GTGAAATTATCAACTCCCATTCTTTGTTGATTGGTGAGCTTGGACTTGGGGACTGCTGGTGCAAATCAGCTTCCCTTGAATGAATTAGCTGGAATTTGATTCGCAGCATATATGCGGTGTGATAATGTCGTCACTGTGTAGCTCGGATTGTCTGGCTTCTAATCGTCCTTCACGGACAACTTGATCTTTTGACCTCAAATCAGGTAGG
.........((((((((((.((......)).))).))).))))..(.(((((..((((((....)))))).))))).)........(((((((...(((((((.(((...(((((((((((((...)))).))))))))))))))))))))))))))((.(.(.((((.....)))).).).))........................
Select All

Show entries per page      Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.