Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (169 hits, page 1)

Show entries per page      Next >>

Lineage of Lentinula: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Marasmiaceae; Lentinula;
Select All
>1002752 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTTGTGGTGGTTTACAACCNTGGTGTGATAATTATCTACATTGTGGTGTGAAATCTCACAATAATAAAGCTCTATTGGTGGGGTGTTNTACATTATAGTTTGCTCAATCTGCTCTACTCAGTAGAGAAAAAGGGNAGCTCTGCTCTCTCTCTGTCTTTTGTGCATATATATAACTTATTTGCTT
.........((((((((((((((....))))).))))).)))).(.(.(((((...((.(((....))).)).))))).))...((..(((...(((...((((((((..(((((..(.((((((((((....)).)))))))))))).)).)))..))))))))...))).))...((.(.((...)).)))...........................................................................................
>1002772 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTNACTTATTAAAGCTTGGATGTTGGAGGNTTGCAGGCGTCTGTCAGCTCCTCTTAAATTTATTAGTGGGANCCCTGTGGTGTTAGTTCTAACCTTGGTGTGATAATTATCTACATTTCGGTGGNCCCCCACAATAATAAACCCCTATGGGTTGGGGTTGTTNAATTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGNTCNGCTTTCTAACTGTCTTGATTGACTATATATAACTTATTTGCTTGA
.........((((((((((((((....))))).))))).)))).....((((((..((.(((....))).))))))))..........(.(..((.((.(....((((((((.(.(((..((((((((....))).)))))..)))))))........))))))........)).))..).)...........(((.....)))..............................................................................
>1002774 see NCBI Nucleotide Lentinula edodes Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATGTTGGAGGCTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGGANCCCTGTTTTGTTAGTTCTAACCTTGGTGTGATAATTATCTACATTTTGGTGGAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTAGTTTGCTCAATCTGTTCTATTCATTGGAGAAAAAGGGAAGTTCTGCTTTCTAACTGTCTTGATTGACTATATATAACTTATTTGCTT
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((.(..(((((((((((((.(.(((..((((((((....))).)))))..)))))).).)......))))))))...)..).))).).)...........(((.....)))............................................................................
>1002762 see NCBI Nucleotide Lentinula edodes Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATGTTGGAGGCTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGGAACCCTGTTTTGTTAGTTCTAACCTTGGTGTGATAATTATCTACATTTTGGTGGAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTAGTTTGCTCAATCTGTTCTATTCATTGGAGAAAAAGGGAAGTTCCGCTTTCTAACTGTCTTGATTGACTATATATAACTTATTTGCTTGA
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((.(..(((((((((((((.(.(((..((((((((....))).)))))..)))))).).)......))))))))...)..).))).).)...........(((.....)))..............................................................................
>1002770 see NCBI Nucleotide Lentinula edodes Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATGTTGGAGGCTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGGAACCCTGTTTTGTTAGTTCTAACCTTGGTGTGATAATTATCTACATTTTGGTGGAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTAGTTTGCTCAATCTGTTCTATTCATTGGAGAAAAAGGGAAGTTCCGCTTTCTAACTGTCTTGATTGACTATATATAACTTATTTGCTTGA
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((.(..(((((((((((((.(.(((..((((((((....))).)))))..)))))).).)......))))))))...)..).))).).)...........(((.....)))..............................................................................
>2921 see NCBI Nucleotide Lentinula edodes Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATGTTGGAGGCTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGGAACCCTGTTTTGTTAGTTCTAACCTTGGTGTGATAATTATCTACATTTTGGTGGAACCTTACAAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTAGTTTGCTCAATCTGTTCTATTCATTGGAGAAAAAGGGAAGTTCTGCTTTCTAACTGTCTTGATTGACTATATATAACTTATTTGCTTGA
.........((((((.(((((((....)))))).)).).)))).....(((((...((.(((....))).)).)))))...........(((((......((((((((((..........((((((((....))).))))))))))))))))))))........(.(..((...)))).........................................................................................................
>5565667 see NCBI Nucleotide Lentinula edodes Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATGTTGGAGGCTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGGAACCCTGTTTTGTTAGTTCTAACCTTGGTGTGATAATTATCTACATTTTGGTGGAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTAGTTTGCTCAATCTGTTCTATTCATTGGAGAAAAAGGGAAGTTCCGCTTTTCTAACTGTCTTGATTGACTATATATAACTTATTTGC
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((.(..(((((((((((((.(.(((..((((((((....))).)))))..)))))).).)......))))))))...)..).))).).)...........(((.....)))...........................................................................
>5565670 see NCBI Nucleotide Lentinula boryana Method 2 (see details)
ATTAAATTCTCAACTTCAACAAGTTTTTACGACTTGATGAAGCTTGGATGTGGAGGCTTGCTGGCGTATTGTTCAGCTCCTCTTAAACATATTAGTGGAAGAAAACCCTGTTTGCTGATCCAACCTAAAGGTGTGATAATTATCTACATTTTTGGTTAGTTCGCAAGTTTTGCTGCTTTGATTATCTTAGGCTGTTGCATTAAGTTGCTCGGTTTGTTGGGTTGCTGCATTAGTTTGCTCAATCTGTTTGATTCACGTCAGANTAACAAGGGAAGTCTGCTTTCTAACTGTCTTCTAATAGGACAACTTATATTTNTTGGTT
...................(((((((((.((...))).)))))))).....(((((...(((((((...)).))))).)))))..........((((((..(...(((((.(((.............((((((((((....))).)))))))))).)))...)...))))))))........((.(....).))................................................................................................................................
>5565671 see NCBI Nucleotide Lentinula boryana Method 2 (see details)
ATTAAATTCTCAACTTCAACAAGTTTTTACGACTTGATGAAGCTTGGATGTGGAGGCTTGCTGGCGTATTGTTCAGCTCCTCTTAAACATATTAGTGGAAGAAAACCCTGTTTGCTGATCCAACCTAAAGGTGTGATAATTATCTACATTTTTGGTTAGTTCGCAAGTTTTGCTGCTTTGATTATCTTAGGCTGTTGCATTAAGTTGCTCGGTTTGTTGGGTTGCTGCATTAGTTTGCTCAATCTGTTTGATTCACGTCAGAGTAACAAGGGAAGTCTGCTTTCTAACTGTCTTCTAATAGGACAACTTATATTTTTGGTTGA
...................(((((((((.((...))).)))))))).....(((((...(((((((...)).))))).)))))..........((((((..(...(((((.(((.............((((((((((....))).)))))))))).)))...)...))))))))........((.(....).)).................................................................................................................................
>1002753 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTTGTGNTGGTTTACAACCTTGGTGTGATAATTATCTACATTTTGNGGTGAAATCTCACAATAATAAAGCTCTATTGNGGTGGGTTGTTGTACATTAGAGTGTTCAATCTCTGCTACTCACTGGAGAGAAAGGGAAGNGCTCTGCTCTCTCTCTCTCTATTGNCTATATATATAACTTATTTGCTTGA
.........(((((((.((((((....)))))).).)).)))).....(((((...((.(((....))).)).)))))..........(((((.(.(....(((((((...((.(.(((((((((((((....))).)))))..)))))))))))..)).......))).))))))...........(((.....)))..........................................................................................
>1002754 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGAAATCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTTTATTGACTATATATAACTTATTTGCTTGA
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((..(((((((((((((.(..(((..((((((((....))).)))))..))..)))).).)......))))))))...)..))))).).)............(((.....)))..............................................................................
>5565668 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGAAATCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTTTATTGACTATATATAACTTATTTGCTTGA
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((..(((((((((((((.(..(((..((((((((....))).)))))..))..)))).).)......))))))))...)..))))).).)............(((.....)))..............................................................................
>5565669 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGAAATCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTTTATTGACTATATATAACTTATTTGCTTGA
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((..(((((((((((((.(..(((..((((((((....))).)))))..))..)))).).)......))))))))...)..))))).).)............(((.....)))..............................................................................
>1002755 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGAAATCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTTAGTTNGCTCAATCTGTTCTACTCATNGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTATATTGACTATATATAACTTATTTGCTTGA
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((..(((((((((((((.(..(((..((((((((....))).)))))..))..)))).).)......))))))))...)..))))).).)............(((.....)))..............................................................................
>1002757 see NCBI Nucleotide Lentinula novae-zelandiae Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTCTTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAACCCTGTTNTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTNTGGTTTGTAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTNCAATTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTNNATTGACTATATATAACTTATTTGCTTGA
.........(((((((((.((((....)))).).)))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((.((((.(((((((..(..(((.(((((((((....))).)))))).))..)).).).)......)))).)))...)..))))).).)............(((.....)))..............................................................................
>1002760 see NCBI Nucleotide Lentinula boryana Method 2 (see details)
ATTAAATTCTCAACTTCAACAAGTTTTTACGACTTGATGAAGCTTGGATGTGGAGGCTTGCTGGCGTATTGTTCAGCTCCTCTTAAACATATTAGTGGAAGAAAACCCTGTTTGCTGATCCAACCTAAAGGTGTGATAATAATCNACATTTTGGGTTAGTTGCCAAGTTTTCCTCCTTTGATTATCTTGGCCTGTTGCATTAAGTTGCTGGGTTTGTTGGGTTCCTGAATAAGTTTGCCCAACCTGTTTNATTNCCNCAANAGAACCAGGGGAAGTCTGCTTTCTAACTGTCTTCTAATAGGACAACTTATATTTTTGGTTGA
.........(((((((((.(.((.(.(...)).))).))))).))))....(((((...(((((((...)).))))).))))).......(((((.(((.((.((....((((((.((..((((((((.((((((((....))).)))))))))))).))))).)))))))).))).))))).....(((....)))..............................................................................................................................
>1002765 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTNNTGTTGGTTNNCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGAAATCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTTTATTGACTATATATATAACTTATTTGCTTGA
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((..(((..((((((((..(.(((..((((((((....))).)))))..))..)))).).)......))))..))...)..))))).).)............(((.....)))................................................................................
>1002766 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGAAATCTTACAATAATAAAGCTCTACTGGTTTGGGTTGTTGCATTTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTTTATTGACTATATATAACTTATTTGCTT
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((..(((((((((((((.(..(((..((((((((....))).)))))..))..)))).).)......))))))))...)..))))).).)............(((.....)))............................................................................
>1002767 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTACATGAGTTTTTACTCATTGAAGCTTGGATGTTGGAGGTTTGCAGNCATTTTGTCAGCTCCTCTTAAATGCATTAGTGGAAAACCCTTGTCTTGTTGGTTTCCAACCTTGGTGTGATAATTATCTACATTGNGGTTTGTAACCTAACAATGATGAAAAAGCTCTATTGGTTTGGGTTGTTGNATTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAASGCTTTCTANCTGTCTTTATTGACTATACATATAACTTATTTGCTTGA
.........((((((.(((((((....)))))).)).).)))).....(((((...((.((((...)))).)).)))))..........((((((....(.(((((((((((((....((..((((((((((....))).)))))..)))).))....)))))).)))...)).).)))))).......((((.......))))................................................................................
>1002763 see NCBI Nucleotide Lentinula novae-zelandiae Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTCTTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAACCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGTAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCAATTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTTTATTGACTATATATAACTTATTTGCTTGA
.........(((((((((.((((....)))).).)))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((.((((((((((((..(..(((..((((((((....))).)))))..))..)).).).)......))))))))...)..))))).).)............(((.....)))..............................................................................
>1002764 see NCBI Nucleotide Lentinula novae-zelandiae Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTCTTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAACCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGTAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCAATTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTTTATTGACTATATATAACTTATTTGCTTGA
.........(((((((((.((((....)))).).)))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((.((((((((((((..(..(((..((((((((....))).)))))..))..)).).).)......))))))))...)..))))).).)............(((.....)))..............................................................................
>1002758 see NCBI Nucleotide Lentinula lateritia Method 2 (see details)
ATTAAATTCTCAACTTTATAAGTTTTTACTTATTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAATTCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGAAATCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCATTTTAGTTTGCTCAATCTGTTCTACTCATTGGAGAAAAAGGGAAGGTCTGCTTTCTAACTGTCTTTATTGACTATATATAACTTATTTGCTT
.........((((((((((((((....))))).))))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((..(((((((((((((.(..(((..((((((((....))).)))))..))..)))).).)......))))))))...)..))))).).)............(((.....)))............................................................................
>1002759 see NCBI Nucleotide Lentinula boryana Method 3 (see details)
TCAACTTCAACAAGTTTTTACGACTTGATGAAGCTTGGATGTGGAGGCTTGCTGGCGTATTGTTCAGCTCCTCTTAAACATATTAGTGGAAGAAAACCCTGTTTGCTGATCCAACCTAAAGGTGTGATAATTATCTACATTTGTGGTTAGTTCGCAAGTTTTGCTGCTTTGATTATCTTAGGCTGTTGCATTAA
(((((((((.((((.........)))).))))).))))....(((((...(((((........))))).))))).........(((((..(......(.((...(((((..(...(.(...(((((((....))).))))).)..))))))...)).))..)))))...........((((.........))))
>1002756 see NCBI Nucleotide Lentinula novae-zelandiae Method 3 (see details)
TCAACTTTATAAGTTTTTACTTCTTAAAGCTTGGATATTGGAGGTTTGCAGGCGTATGTCAGCTCCTCTTAAATTTATTAGTGGAACCCTGTTTTGTTGGTTTTCANCCTTGGTGTGATAATTATCTACATTTTGGTTTGTAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGC
((((((((..((((....))))...)))).))))...(.(((((...((.(((....))).)).))))).)..((.((.(.((.(..........((((.....(......((((((((....))).)))))...)....))))..).)).).)).)).........(((......)..))
>1002761 see NCBI Nucleotide Lentinula novae-zelandiae Method 3 (see details)
TCAACTTTATAAGTTTTTACTTCTTAAAGCTTGGATATTGGAGGTTTGCAGGCGTTTGTCAGCTCCTCTTAAATTTATTAGTGGAACCCTGTTTTGTTGGTTTTCAACCTTGGTGTGATAATTATCTACATTTTGGTTTGTAACCTTACAATAATAAAGCTCTATTGGTTTGGGTTGTTGCAATTTAGTTTGCTCAAT
(((((((((.((((....)))).).)))).)))).....(((((...((.(((....))).)).)))))..........(.(.(((((.((((((((((((..(..(((..((((((((....))).)))))..))..)).).).)......))))))))...)..))))).).)............(((.....)))
Select All

Show entries per page      Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.