Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (2041 hits, page 1)

Show entries per page      Next >>

Lineage of Tremellomycetes: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes;
Select All
>3169480 see NCBI Nucleotide Tremella microspora Method 1 (see details)
ATGAACTCTCAATCCTCTCGGGTTTCCGATTGGATTGGACTTGGGTGTTGCCGTCTGGCTCACCTTAAATGACTTAGTGGATCTCTCCCCTAGTCGATGTAATAACTTTCATCGGTGAAGGGTCTAGTCTGCTCACAATCGCCTTTGCTGGC
........(((((((..((((....))))..)))))))....(((((..(((....))).)))))..........(((((((.....((((.(((((((.((....)).)))))))..))))....))))))).......(((......)))
>304471 see NCBI Nucleotide Cryptococcus neoformans Method 2 (see details)
ATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGGTGATAACAACCATCTCTTTTTTGTTTGA
....(((((.((((((..(((((......)))))..))).))))))))(((((...((((((.(((....))).)).)))).))))).......((((.((((..((.((((((((..((((((((((.((....)).)))))))).)..))))))))).))..)))).))))..(((.((.........)).))).
>304472 see NCBI Nucleotide Cryptococcus gattii Method 2 (see details)
ATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGGAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGGTGATAACAACCATCTCTTTTTTGTTTGA
....(((((.((((((..(((((......)))))..))).))))))))(((((...((((((.(((....))).)).)))).))))).......((((.((((..((.((((((((..((((((((((.((....)).)))))))).)..))))))))).))..)))).))))..(((.((.........)).))).
>3169454 see NCBI Nucleotide Tremella encephala Method 2 (see details)
ATGAACTCTCAATCCCCTCGGGTTTCCGATCGGGTTGGACTTGGGTGCTGCCGTATGGCTCACCTCAAATGACTTAGTGGATGTCTCCCCTAGTCGATGTAATAAGTTTCATCGATGACGGGTTCAGTCTGCTCACAACCGCCTTTACTGGCAACATTTGTACTCT
...((.((.((((((..((((....))))..)))))))).))(((((..(((....))).)))))..........(((((((...((((.(.(((((((.((....)).))))))))..)))...)))))))).......(((......)))..............
>3169456 see NCBI Nucleotide Tremella encephala Method 2 (see details)
ATGAACTCTCAATCCCCTCGGGTTTCCGATCGGATTGGACTTGGGTGCTGCCGTATGGCTCACCTCAAATGACTTAGTGGATGTCTCCCCTAGTCGATGTAATAAGTTTCATCGATGACGGGTCCAGTCTGCTCACAACCGCCTTTACTGGCAACATTTGTACTCT
...((.((.((((((..((((....))))..)))))))).))(((((..(((....))).)))))..........(((((((...((((.(.(((((((.((....)).))))))))..)))...)))))))).......(((......)))..............
>3169453 see NCBI Nucleotide Holtermannia corniformis Method 2 (see details)
GTGAACAACCTCAACCTTGATTGGTTCCAATCAAGGCTTGGACTTGGGTGCTGCCGCTGCGAAGCGGCTCACCTTAAAATCATTAGCTGGACTTGTCTATGACTTGGTTCGACTCGGTGCAATAAGTATTCACCGGGGACAGAGTAATCTGGCCAAGGCTTGATGCCGTCTGCTTCCAACACTGTTCTCACTACGAGACACTACTTTACTGTGTGG
..........(((((((((((((....))))))))).))))....(((((..((((((...).))))).))))).............((((.((((((..(..(.....(..(((((((.(.(....)).)))))))))))).))))))))..........(((...)))..............................................
>3169473 see NCBI Nucleotide Tremella globispora Method 2 (see details)
ATGTAGACTCAACCCCTCGGGTTTTTGCCCGGGGTGAGTTTGGATTTGGGCCTTGCCTGACCGGCTGGCCTTAAAAGTGTTAGTGGATTCGCACAGACGTTGTAAGCACTCGTCGAGGCGGCCCGCTCATAACCCCCCATATTTTGCACTCT
(.(((((((....(((((((((....)))))))).)))))))..)).(((((..(((.....))).)))))......(((.(((((.(..((.(.((((.((....))..))))).).)).)).))).))).......(.(.(....).).)
>3169457 see NCBI Nucleotide Tremella flava Method 2 (see details)
TTGTAGACTCAACCCCTCGGGTTTCTGACCCGGGGGCGTTGGATTTGGGCCCTTGCCTCCCCCGGCTGGCCTTAAATGCGTCAGTGGCTTTTTCACGCAGACGTCGTAAGTTACGCGTCGACCGTGGGCCGCTCACAACACCCCCTACTTTTGCACTCTGG
..((((.(.....((((((((((...)))))))))).))))..)..(((((...(((......))).))))).......((.((((..((..(.((((.((((.((.....)..)))))).).)))))).))).)).......(..(..(....).)..).
>3169458 see NCBI Nucleotide Tremella flava Method 2 (see details)
TTGTAGACTCAACCCCTCGGGTTTCTGACCCGGGGGCGTTGGATTTGGGCCCTTGCCTCCCCCGGCTGGCCTTAAATGCGTCAGTGGCTTTTTCACGCAGACGTCGTAAGTTACGCGTCGACCGTGGGCTGCTCACAACACCCCCTACTTTTGCACTCTGG
..((((.(.....((((((((((...)))))))))).))))..)..(((((...(((......))).))))).......((.((((..((..(.((((.((((.((.....)..)))))).).)))))).))).)).......(..(..(....).)..).
>3169461 see NCBI Nucleotide Tremella fuciformis Method 2 (see details)
ATGTAGACTCAACCCCCCGGGTTTCTGACCCGGCGGTGTTGGATTTGGGCCCTGCCTCTCTGGCTGGCCTTAAATGCGTTAGTGGTTTCACGCAGACGTCGTAAGTTACGCGTCGACTGTGGGCCGCTCACAACCCCCTTTACTTTTGCACTCTGG
(.((((.(...(.((.(((((((...))))))).)))))))..)).(((((..(((.....))).))))).......((.((((.(.(.((((.((((.((.....)..)))))).).)))).).))).)).......(..(..(....).)..).
>3169459 see NCBI Nucleotide Tremella flava Method 2 (see details)
TTGTAGACTCAACCCCCCGGGTTTCTGACCCGGGGGCGTTGGATTTGGGCCCTTGCCTCCCCCGGCTGGCCTTAAATGCGTCAGTGGCTTTTTCACGCAGACGTCGTAAGTTACGCGTCGACCGTGGGCCGCTCACAACACCCCCTACTTTTGCACTCTGG
..((((.(.....((((((((((...)))))))))).))))..)..(((((...(((......))).))))).......((.((((..((..(.((((.((((.((.....)..)))))).).)))))).))).)).......(..(..(....).)..).
>3169463 see NCBI Nucleotide Tremella flava Method 2 (see details)
TTGTAGACTCAACCCCCCGGGTTTCTGACCCGGGGGCGTTGGATTTGGGCCCTTGCCTCCCCCGGCTGGCCTTAAATGCGTCAGTGGCTTTTTCACGCAGACGTCGTAAGTTACGCGTCGACCGTGGGCCGCTCACAACACCCCCTACTTTTGCACTCTGG
..((((.(.....((((((((((...)))))))))).))))..)..(((((...(((......))).))))).......((.((((..((..(.((((.((((.((.....)..)))))).).)))))).))).)).......(..(..(....).)..).
>3169462 see NCBI Nucleotide Tremella fuciformis Method 2 (see details)
ATGTAGACTCAACCCCCCGGGTTCCTGACCCGGCGGTGTTGGATTTGGGCCCTGCCTCTCCTGGCTGGCCTTAAATGCCTTAGTGGTTTCACGCAGACGTCGTAAGTTACGCGTCGACTGTGGGCCGCTCACAACCCCCCCTACTTTTGCACTCTGG
..((((.(...(.((.(((((((...))))))).)))))))..)..(((((..(((......))).)))))........(.((((.(((.((((.((((.((.....)..)))))).).)))))).))).)........(..(..(....).)..).
>3169469 see NCBI Nucleotide Tremella foliacea Method 1 (see details)
ATGAAAATCTCATCCCATCGGGTTTCCGATGATGATGGACTTGGGTGTTGCCGTCCCTGGCTCGCCTTAAAGGTGTTAGCGGTTCCGAAGTCGAATCTGGCGTAATAAGTTTCGCTGGCCTAGATCGAAGGCTGCTCCTAACCCGTCTTCTGACATTTTTTGCTCTGA
.........(((((.((((((....))))))..)))))....(((((..(((......))).)))))....((.(((((.(((.((....((((.(((((.((....(((...))).))))))))))).))..))).)))))))(((....)))..............
>3169466 see NCBI Nucleotide Tremella nivalis Method 1 (see details)
ATGAAATATCAATCCCCCGGGTTTGTAATGAACCCGTCGGACTTGGACTTGGGTGTTTGCCGTGTCACAACGGCTCGCCTTAAATGCATCATGGTGGTTTGGCCCTGTGCGGACAGGACGTGATAAGTCGTCGTCCCATCTGCCTTGGCCCCGCCTCATAAACCGTCCTCGGACACCTTTTTCATCTCTGA
........(((((((..(((((((.....)))))))..))).))))....(((((...(((((......))))).)))))............(((((...((((....(((((..((((((((....))).)))))..)))))...))))))))).............(((((.............)))))
>3169467 see NCBI Nucleotide Tremella neofoliacea Method 1 (see details)
ATGAAAATCTCATCCCATCGGGTTTCCGATGATGATGGACTTGGGTGTTGCCGTCCTTGGCTCGCCTTAAAGGTGTTAGCGGTTCCGAAGTCGAATCTGGCGTAATAAGTTTCGCTGGCCTAGATCGAAGGCTGCTCCTAACCCGTCTTCTGACATTTTTTGCTCTGA
.........(((((.((((((....))))))..)))))....(((((..(((......))).)))))....((.(((((.(((.((....((((.(((((.((....(((...))).))))))))))).))..))).)))))))(((....)))..............
>3169470 see NCBI Nucleotide Tremella neofoliacea Method 1 (see details)
ATGAAAATCTCATCCCATCGGGTTTCCGATGATGATGGACTTGGGTGTTGCCGTCCTTGGCTCGCCTTAAAGGTGTTAGCGGTTCCGAAGTCGAATCTGGCGTAATAAGTTTCGCTGGCCTAGATCGAAGGCTGCTCCTAACCCGTCTTCTGACATTTTTTGCTCTGA
.........(((((.((((((....))))))..)))))....(((((..(((......))).)))))....((.(((((.(((.((....((((.(((((.((....(((...))).))))))))))).))..))).)))))))(((....)))..............
>3169471 see NCBI Nucleotide Tremella nivalis Method 1 (see details)
ATGAAATATCAATCCCCCGGGTTTGTAATGAACCCGTCGGACTTGGACTTGGGTGTTTGCCGTGTCACAACGGCTCGCCTTAAATGCATCATGGTGGTTTGGCCCTGTGCGGACAGGACGTGATAAGTCGTCGTCCCATCTGCCTTGGCCCCGCCTCATAAACCGTCCTCGGACACCTTTTTCATCTCTGA
........(((((((..(((((((.....)))))))..))).))))....(((((...(((((......))))).)))))............(((((...((((....(((((..((((((((....))).)))))..)))))...))))))))).............(((((.............)))))
>3169474 see NCBI Nucleotide Tremella moriformis Method 1 (see details)
ATGAAATCTCAATCCCCTCGGGTTTTTCGACCCGGGTGGGACTTGGACTTGGGCGTCTTGCCATCCGTGGCTCGCCTTAATGGTGTCAGTGGGACTTTGTATCCGATCATCAGACGTAATAAGTTTCGTCTGTATGGGAGACGGAGGCCTGCTCATAACCCTTGCTTCCTCCTCGGAGGGACACACTTTTTCGATCTGA
........((((((((((((((((....)))))))).)))).))))....(((((....((((....)))).)))))....(((((.((((((.((((((.(((.((...((((((.((....)).)))))).)).))).)))))).)))))).)).)))....(((((.....)))))....................
>3169475 see NCBI Nucleotide Tremella simplex Method 1 (see details)
ATGAATAACTCATCCCACCGATTCTTTCGTTGGGGTGGATCTGGGTGTTGCCGTCCGGCTCGCCTTAAAGATGTTAGCGGTTCCGAGGATGAACCTGGCGTAATAAGTTTCGCTAGTCAAGTCTGAAGGCTGCTCATAACCCGTCTTCTGACACTTTTGCTCTGA
.........((((((((.(((.....))).))))))))....(((((..(((....))).)))))......(((.(((((((....((((....((((((.((....)).))))))....))))...))))))).)))....(((....))).............
>3169476 see NCBI Nucleotide Tremella exigua Method 1 (see details)
ATGAAATCTCACTCCCTTTGGGTTTTACGACCCGATTGGACGTGGACTTGGGCGTCCTGTCTTTTGTTAGACTCGCCTCAAATGGATCAGTGGAAAGAGAGCTGATGGCTAAGACGTAATAAGTTTCGTCCGCGCCGGGCTCAGACGTCTGCTCACAACCAACCATATTTCTGACTCTGA
........(((((((..(((((((....)))))))..))).))))....(((((....((((......)))).)))))...........(((((..((((.((.((.((......)).)).)))))).)))))..((((.(((((.((.((............)).)).))))).)))).
>3169477 see NCBI Nucleotide Tremella mycophaga Method 1 (see details)
ATGAATAACTCATCCCACCGATTCTTTCGTTGGGGTGGATCTGGGTCTTGCCGTCCGGCTCGCCTTAAAGATGTTAGCGGTTCCGAGGATGAACCTGGCGTAATAAGTTTCGCTAGTCAAGTCTGAAGGCTGCTCATAACCCGTCTTCTGACACTATTGCTCTGA
.........((((((((.(((.....))).))))))))....((((...(((....)))..))))......(((.(((((((....((((....((((((.((....)).))))))....))))...))))))).)))....(((....))).............
>3169478 see NCBI Nucleotide Tremella tropica Method 1 (see details)
ATGTGGACTTCGACCCCGAGGGTTATCCCTCCGGGGCCGGACTTGGGCGCCGCCTTATCGGCCCGCCTGAAATGCATCAGCGGGACACACGTCGTAAGCACCGTCCGTGTCCCGCCCAGAGAACACCTTTTCGTGACTCTGA
........((((.(((((((((....)))).))))).)))).(((((((..(((.....))).))))))).........((((((((((((..........)))..))))))))).(((((..(((......))).))))).
>3169479 see NCBI Nucleotide Tremella mesenterica Method 1 (see details)
ATGTGGACTTCGACCCCGGGGGTTATTCCCCCGGGGCCGGACTTGGGCGCCGCCTCACCCGGCCCGCCTCAAATGCATCAGCGGGACGCGACGTCATAAGCACCGTCCGTGTCCCGCCCACAGAACACCCATCTCGTAACTCTGA
........((((.(((((((((.....))))))))).))))...(((((..(((......))).)))))...........(((((((((((((..........))).))))))))))...((((((.........))...)))).
>3169460 see NCBI Nucleotide Tremella mesenterica Method 1 (see details)
ATGTGGACTTCGACCCCGAGGGTTATTCCCCCGGGGCCGGACTTGGGCGCCGCCTCACCCGGCCCGCCTCAAATGCATCAGCGGGACGCGACGTCATAAGCACCGTCCGTGTCCCGCCCACAGAACACCCATCTTGTAGCTCTGA
........((((.(((((.(((.....))).))))).))))...(((((..(((......))).)))))...........(((((((((((((..........))).))))))))))...(((((((.......)))...)))).
Select All

Show entries per page      Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.