Koetschan et al. (2010) NAR 38:D275-9
Selig et al. (2008) NAR 36:D377-380.
Schultz et al. (2006) NAR 34:W704-7.
Select a database version:
 
     
Browse
   
Predict
   
Model
   
Annotate
   
Motif
   
Tools
 
About
Flowchart
What's new
Citation
Cited by > 150
Press releases
Statistics
Updates
Supplements
Links
ITS2 in PubMed
ITS2 highlights
Staff
Funding
Acknowledgements
ITS2 group
publications

ITS2 of the month
Awards
Usage policy
Fun



ITS2 3D structure
(Keller et al. 2010)


Chlorophyta hypertree

(Buchheim et al. 2011)
Fig1, Fig2, Fig3, Fig4

Search results (93 hits, page 1)

Show entries per page      Next >>

Lineage of environmental samples: root; cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Cantharellales; Clavulinaceae; environmental samples;
Select All
>114414789 see NCBI Nucleotide uncultured Clavulinaceae Method 2 (see details)
GTGAAATTCTCAAGCTAGATGCTTTTTTGTATCTCGGTTTGGTTATTGGGCTCTGCCGTGTCCTTCATTGGGACGGCTGGCCTTAAAGGCATTAGCTGACCCTCATGATGGCATTGGTTCTACTCAGCGTGATAATAATCTGACCGCTGAGGACATCTTTCGGGATGGCCAATTCTCGTTTGGGTTGCTCTCTAATCTGGATTATGGGTTGCCAACCAGCAATCTATTCCATTTTCAACTTTGA
.........(((((((((((((......)))))).))))))).....((.(...(((((..(((.....)))))))).).))...........((.((.((.((.((((.((.(((((..........(((((....))).)..)))))).).)))....)).)).)).)).)).......(((......)))...................................................
>27497404 see NCBI Nucleotide Clavulinaceae sp. D44 Method 2 (see details)
GTGAAATTCTCAAGCTAGATGCTTTTTTGTATCTCGGTTTGGTTATTGGGCTCTGCCGTGTCCTTCATTGGGACGGCTGGCCTTAAAGGCATTAGCTGACCCTCATGATGGCATTGGTTCTACTCAGCGTGATAATAATCTGACCGCTGAGGACATCTTTCGGGATGGCCAATTCTCGTTTGGGTTGCTCTCTAATCTGGATTATGGGTTGCCAACCAGCAATCTATTCCATTTTCAACTTTGA
.........(((((((((((((......)))))).))))))).....((.(...(((((..(((.....)))))))).).))...........((.((.((.((.((((.((.(((((..........(((((....))).)..)))))).).)))....)).)).)).)).)).......(((......)))...................................................
>116876118 see NCBI Nucleotide uncultured Clavulina Method 2 (see details)
GCGAAATTTCTCAAGCTTTGGATGGGCTTTGTTGTCTGTCCTTAGCCTTGGTTTTGTTGGGCTTTGCCGTGTCCTTCATTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCTAAACCTGGTTTTACAGATTCTTCAATCTGTTCCACTTTTCAGCTTTGA
..........(((((((.(((((.(((...)))))))).....))).)))).((.(..((.(...(((((.(((.......)))))))).).))).)).......(.(......(((.(.(..(.((.((....((((((((((....))).)..)))))))).)))).).)))).)............((((((.....)))))).............................................
>31074219 see NCBI Nucleotide uncultured Clavulina Method 2 (see details)
GAAACTCTCAAACAAAGTAGATTCGTTTCTACCTCTGTTTGGATTTGGACTCTGCTGCGTCAATGCGGCTGGTCTTAAATATATTAGCTGATCCTAGCGAAGGTTTGGTTCTACTCAGCATGATAATTATCTGATGTTGAGGACAGTCTTAGGACTGGCCAGGCTCTCTATGGATTGCTTCCAATCGTCTTTGGACAATCATTCAATATCTGA
.......(((((((.((((((......))))).).)))))))....(((((..((((((....)))))).)))))...........((((.((((....((((.(((..(.(.((((((((..(((...).))))))))))))))))))))))).)))).............(((((.(.(.((.....)).)).))))).............
>148612679 see NCBI Nucleotide uncultured Clavulina Method 2 (see details)
GTGAAATTTCTCAAGCTTTGGATGGCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTTGTGTGCCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTTCTCATTTGGGTTGCTTCTAAACTTGGTTTTGCAGATTCTTGAATCTGTGTTCCACTTTTCAGCTTTGA
..........(((((((..(((((((.....))).))))..))).)))).....((.(...((..((((((.....)))))))).).))...........(((((....((((.((..(.((.((...(((((((((((....))).)..))))))))))))....)))..))).)))))(((....)))..........................................................
>156634987 see NCBI Nucleotide uncultured Clavulinaceae Method 2 (see details)
ACGAAATTTCTCAAGCTAGGATGGCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGTCCTCATTTGGGTTGCTTCTAAACTTGGTTTCGCGGATTGTTCAATCTGCGTTCCACTTTTCAGCTTTGA
..........((((((((((((((.(....).))))))).))).)))).....((.(...(((((.((.......)).))))).).))...........(((.(((((((((.(..((..((.(.(.(((((((((((....))).)..))))))).).).))..))).)))).............))))))))..(((...((((((...)))))))).)..........................
>104304696 see NCBI Nucleotide uncultured Clavulinaceae Method 2 (see details)
GTGAAGTTCTCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGTTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTCTAATCTGGTTGCAAGATCTTGAATCCTGCTCATTTTCATTTTGA
.........(((((((((((((......)).........)).)..).)))))))....(((((..((((..(..(((....)))))))).))))).......(..(((..(.(.(((.(...((.(((((((((((((((((((((....))).)..)))))))....).....))...)))))))))).)..))).).))))........(((....)))...........................
>111608685 see NCBI Nucleotide uncultured Clavulinaceae Method 2 (see details)
GTGAAATTCTCAAACCGGGATGCTTTTTTTGTTTCTCGGCTTGGTGTTGGGCTTTGCAGTTCCTTTGATTGGGATGGCTGGCCTTAAAAGCATTAGCTGGCTTTTCATGTGGCATTGGTTCTACTCAGCGTGATAATGATCTGACCGCCGAGGACATCTTTCGAGGTGGCCAATTCTCATTTGGGCTGCTTCTAATTTTGGTAGAGCAGATTCTGAATCTGTTCCACTTTTCAGCTTTTGA
.........((((.((((((.((.......)).)))))).))))....((.(...((.((..(((.....))))).)).).))...........((.(((((.((..((((.(.(((((..........(((((....))).)..)))))).).))).....).)).))))).)).......(((.....)))................................................
>91199891 see NCBI Nucleotide uncultured Clavulinaceae Method 2 (see details)
ACGAAATTTCTCAAGCTTGGATGGATTTTTTGTCCGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGTACGGCTGGCCTTAAAAGCATCAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGACATCTTTTGGGATGGCCAGCTCTCATTTGGGTTGCTTCTAAACTTGGCTTCACAGATTGTACAATCTGTGTTCCACATTTCAGCTTNGA
.((((..((((((((.(((((((((..(...)))))).).))).))))).....))).))))..(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((....((.(((.(((((.((((....)))).)).))).))))).)))))))))).)))........(((...((((((.(.....)))))))..)))..............
>157086827 see NCBI Nucleotide uncultured Clavulina Method 2 (see details)
ACGAAATTTGTCAAGCTTGGATGGCCTTTTTTGTCTGTCCATTAGCCTTGGTTGTTGGGCTTTGCCGTATCCTTTATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGCGTGGCACTGGTTCTACTCAGCGTGATAATACATCTGATCGCTGAGGACATCTTTCAGGATGGCCAGTCCTCATTTGGGTTGCTTCTAAACCTGGTTTTGCAGATTCTTGAATCTGCGTTCCACTTTTCAGCTTTGA
.((((..((((((((((.((((((.(......).)))))..).)).)))))).....)).))))..((.((...(.(.(((.((((((((..(...)))..)))))).)))..).).)).)).(((...((((((.((((......(.(((.((((((.(((....)))).)).))).))))..)))))))))).))).........((...((((((.(.....)))))))..))...............
>157086829 see NCBI Nucleotide uncultured Clavulina Method 2 (see details)
ACGAAATTTGTCAAGCTTGGATGGCCTTTTTTGTCTGTCCATTAGCCTTGGTTGTTGGGCTTTGCCGTATCCTTTATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGCGTGGCACTGGTTCTACTCAGCGTGATAATACATCTGATCGCTGAGGACATCTTTCAGGATGGCCAGTCCTCATTTGGGTTGCTTCTAAACCTGGTTTTGCAGATTCTTGAATCTGCGTTCCACTTTTCAGCTTTGA
.((((..((((((((((.((((((.(......).)))))..).)).)))))).....)).))))..((.((...(.(.(((.((((((((..(...)))..)))))).)))..).).)).)).(((...((((((.((((......(.(((.((((((.(((....)))).)).))).))))..)))))))))).))).........((...((((((.(.....)))))))..))...............
>157086828 see NCBI Nucleotide uncultured Clavulina Method 2 (see details)
ACGAAATTTGTCAAGCTTGGATGGCCTTTTTTGTCTGTCCATTAGCCTTGGTTGTTGGGCTTTGCCGTATCCTTTATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGCGTGGCACTGGTTCTACTCAGCGTGATAATACATCTGATCGCCGAGGACATCTTTCAGGATGGCCAGTCCTCGTTTGGGTTGCTTCTAAACCTGGTTTTGCAGATTCTTGAATCTGCGTTCCACTTTTCAGCTTTGA
.((((..((((((((((.((((((.(......).)))))..).)).)))))).....)).))))..((.((...(.(.(((.((((((((..(...)))..)))))).)))..).).)).)).(((...((((((.((((......(.(((.((((((.(((....)))).)).))).))))..)))))))))).))).........((...((((((.(.....)))))))..))...............
>27497402 see NCBI Nucleotide Clavulinaceae sp. F46 Method 2 (see details)
GTGAAATTCTCAAACTGGGATGCTTTTTTGTTTCTCGGCTTGGTGTTGGGCTTTGCAGTTCCTTTGATTGGGATGGCTGGCCTCAAAAGCATTAGCTGGCTTTTCATGTGGCATTGGTTCTACTCAGCGTGATAATAATCTGACCGCCGAGGACATCTTTCGAGATGGCCAATTCTCATTTGGGCTGCTTCTAATTTTGGTAGAGCGGATTCTGAATCTGTTCCACTTTTTCAACTTTTGA
.........((((.((((((.((......)).)))))).))))....((.(...((.((..(((.....))))).)).).))...........((.(((((.((..((((.(.(((((..........(((((....))).)..)))))).).))).....).)).))))).)).......(((.....))).................................................
>95118535 see NCBI Nucleotide uncultured Clavulinaceae Method 2 (see details)
GTGAAGTTCTCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTTGACCCTTCACGTGGTATTGGTTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTGCAAGATTCTTGAATCCTGCTCCATTTTTCAATTTGA
.........((((((((((((.((.(.((.....))))).)))..)))))))))....((((...((((..(.((......)).))))).).)))..........(((...(((((..((((.((.(((((((((((((((((((((....))).).).))))))....).....))...)))))))))).)).)))))))))..........(((....)))..............................
>148612667 see NCBI Nucleotide uncultured Clavulina Method 2 (see details)
GTGAAATTCTCAAACCGGGATGCTTTTTTGTTTCTCGGCTTGGTGTTGGGCTTTTGCAGTTCCTTTGATTGGGATGGCTGGCCTCAAAAGCATTAGCTGGCTTTTCATGTGGCATTGGTTCTACTCAGCGTGATAATGATCTGACCGCCGAGGACATCTTTCGAGATGGCCAATTCTCATTTGGGCTGCTCCTAATTTTGGTCGAACGGATTCTGAATCTGTTCCACTTTTCAGCTTTTGA
((((((.((((((.((((((.(...(...).))))))).)))).....)).)))))).((.((...(((.((.(((((((((.(...).))..))))))..)))..)).))).)).(((...((((((.((((....(((.((.((((((.(((....))))).).))).))))).))))))))).))))........(((...((((((.(....))))))))))...............
>104304698 see NCBI Nucleotide uncultured Clavulinaceae Method 2 (see details)
GTGAAGTTCTCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGTTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGATTCTTGAATCCTGCTCCATTTTTCAATTTTGA
.........((((((((((((.((.(.((.....))))).)))..)))))))))....((((...((((..(.((......)).))))).).)))..........(((..(((((..((((.((.(((((((((((((((((((((....))).).).))))))....).....))...)))))))))).)).)))))))))..........(.((....)))...............................
>104304700 see NCBI Nucleotide uncultured Clavulinaceae Method 2 (see details)
GTGAAGTTCTCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGTTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGATTCTTGAATCCTGCTCCATTTTTCAATTTTGA
.........((((((((((((.((.(.((.....))))).)))..)))))))))....((((...((((..(.((......)).))))).).)))..........(((..(((((..((((.((.(((((((((((((((((((((....))).).).))))))....).....))...)))))))))).)).)))))))))..........(.((....)))...............................
>104304701 see NCBI Nucleotide uncultured Clavulinaceae Method 3 (see details)
TCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATCTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGTTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGAT
((((((((((((.((.(.((.....))))).)))..)))))))))....((((...((((..(.((......)).))))).).)))..........(((..(((((..((((.((.(((((((((((((((((((((....))).).).))))))....).....))...)))))))))).)).)))))))))..........(.((....)))
>104304697 see NCBI Nucleotide uncultured Clavulinaceae Method 3 (see details)
TCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGCTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGAT
((((((((((((.((.(.((.....))))).)))..)))))))))....((((...((((..(.((......)).))))).).)))..........(((..(((((..((((.((.(((((((((((((((((((((....))).).).))))))....).....))...)))))))))).)).)))))))))..........(.((....)))
>104304708 see NCBI Nucleotide uncultured Clavulinaceae Method 3 (see details)
TCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGTTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGAT
((((((((((((.((.(.((.....))))).)))..)))))))))....((((...((((..(.((......)).))))).).)))..........(((..(((((..((((.((.(((((((((((((((((((((....))).).).))))))....).....))...)))))))))).)).)))))))))..........(.((....)))
>104304706 see NCBI Nucleotide uncultured Clavulinaceae Method 3 (see details)
TCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGTTCTACTCGGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGATCTTG
(((((.(..(((..(....)..)).)...).).........))))....((.(...(((((.((........)).))))).).))...........(((..(((((.((((.(..((..((.(.(.(((((((((((....))).)..))))))).).).))..))).)))).............))))))))...((....(((((...))))).))
>104304704 see NCBI Nucleotide uncultured Clavulinaceae Method 3 (see details)
TCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTTGACCCTTCACGTGGTATTGGTTCTATTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGAT
((((((((((((.((.(.((.....))))).)))..)))))))))....((((...((((..(.((......)).))))).).)))..........(((...(((((..((((.((.(((((((((((((((((((((....))).).).))))))....).....))...)))))))))).)).)))))))))..........(.((....)))
>104304703 see NCBI Nucleotide uncultured Clavulinaceae Method 3 (see details)
TCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGTGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGTTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGAT
((((((((((((.((.(.((.....))))).)))..)))))))))....((((...((((..(.((......)).))))).).)))..........(((..(((((..((((.((.(((((((((((((((((((((....))).).).))))))....).....))...)))))))))).)).)))))))))..........(.((....)))
>104304695 see NCBI Nucleotide uncultured Clavulinaceae Method 3 (see details)
TCAAGCTAGGTGCTTTTTTGCTTGACAAAAATGCGGTTAGCTTGGTATTGGGCTTTGCCGTGTCCTTCATTTGGAACGGCTGGTCTTAAAGACATTAGCTTGACCCTTCACGTGGTATTGGTTCTACTCAGCGTGATAATAATCTAACCGCTGAGGACATCTTTTGGGGTGGCCAATTCTTGTTGGGGTTGCTTTCTAATCTGGTTTGCAAGAT
(((((((((......((((.........))).)...)))))))))....(((((....(..(........).......)..)))))..........(((..(.(((....((.((...(((((((((((((((((((....))).)..)))))))........)...)).)))))..)).)...))))).))).....((((........))))
>87244877 see NCBI Nucleotide uncultured Clavulinaceae Method 3 (see details)
GTGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTTGTGCGGCACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGRCATCTTTTGGGATGGCCAGTCCTCATTTGGGTTGCTTATAGACCTGGTCTTGCAGATTGTTCAATCTGTGGCTCCA
(((((..((((((((.((((((((...(...).)))).).))).))))).....))).))))).(((((...(((.((.(((((((((..(...)))..)))))).)))..))).))))).(((...((((((.((((.....(.(((.(((((.(((......))).)).))).))))..)))))))))).)))........(((...((((((.(.....)))))).)..)))
Select All

Show entries per page      Next >>


Used methods

Id Description*
1 Unafold - Direct
2 Homology modeled
3 Partial structure
*These structures have been modeled as accurately as possible, but represent only template based predictions and thus may be not as accurate as experimentally verified RNA structures

If you use the database please cite.